ID: 1009710119

View in Genome Browser
Species Human (GRCh38)
Location 6:67307579-67307601
Sequence CACAACGCTGATAGTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009710117_1009710119 4 Left 1009710117 6:67307552-67307574 CCTTGAGACTTGCTGAATGGCTT No data
Right 1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009710119 Original CRISPR CACAACGCTGATAGTGATAA TGG Intergenic
No off target data available for this crispr