ID: 1009713827

View in Genome Browser
Species Human (GRCh38)
Location 6:67361330-67361352
Sequence TAAGCTCCCACTTTTAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009713827_1009713828 6 Left 1009713827 6:67361330-67361352 CCTCACTTAAAAGTGGGAGCTTA No data
Right 1009713828 6:67361359-67361381 AGCACACATGTACCTAAACATGG No data
1009713827_1009713831 24 Left 1009713827 6:67361330-67361352 CCTCACTTAAAAGTGGGAGCTTA No data
Right 1009713831 6:67361377-67361399 CATGGGAACAATAGACACTGTGG 0: 28
1: 253
2: 1015
3: 2316
4: 5084
1009713827_1009713829 7 Left 1009713827 6:67361330-67361352 CCTCACTTAAAAGTGGGAGCTTA No data
Right 1009713829 6:67361360-67361382 GCACACATGTACCTAAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009713827 Original CRISPR TAAGCTCCCACTTTTAAGTG AGG (reversed) Intergenic
No off target data available for this crispr