ID: 1009713828

View in Genome Browser
Species Human (GRCh38)
Location 6:67361359-67361381
Sequence AGCACACATGTACCTAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009713827_1009713828 6 Left 1009713827 6:67361330-67361352 CCTCACTTAAAAGTGGGAGCTTA No data
Right 1009713828 6:67361359-67361381 AGCACACATGTACCTAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009713828 Original CRISPR AGCACACATGTACCTAAACA TGG Intergenic
No off target data available for this crispr