ID: 1009715664

View in Genome Browser
Species Human (GRCh38)
Location 6:67391558-67391580
Sequence AAGGGCCTTCTGTCCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009715654_1009715664 23 Left 1009715654 6:67391512-67391534 CCTATGACACCTAACAGTCCTTC No data
Right 1009715664 6:67391558-67391580 AAGGGCCTTCTGTCCTCTGCAGG No data
1009715656_1009715664 14 Left 1009715656 6:67391521-67391543 CCTAACAGTCCTTCCTGGATAAA No data
Right 1009715664 6:67391558-67391580 AAGGGCCTTCTGTCCTCTGCAGG No data
1009715658_1009715664 5 Left 1009715658 6:67391530-67391552 CCTTCCTGGATAAACGCCTAGGC No data
Right 1009715664 6:67391558-67391580 AAGGGCCTTCTGTCCTCTGCAGG No data
1009715659_1009715664 1 Left 1009715659 6:67391534-67391556 CCTGGATAAACGCCTAGGCACTG No data
Right 1009715664 6:67391558-67391580 AAGGGCCTTCTGTCCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009715664 Original CRISPR AAGGGCCTTCTGTCCTCTGC AGG Intergenic
No off target data available for this crispr