ID: 1009717111

View in Genome Browser
Species Human (GRCh38)
Location 6:67412109-67412131
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009717111_1009717115 12 Left 1009717111 6:67412109-67412131 CCTTTTTCTATCTTTATTAGCCC No data
Right 1009717115 6:67412144-67412166 TAAAATGTTATAAAATGCAAAGG No data
1009717111_1009717116 16 Left 1009717111 6:67412109-67412131 CCTTTTTCTATCTTTATTAGCCC No data
Right 1009717116 6:67412148-67412170 ATGTTATAAAATGCAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009717111 Original CRISPR GGGCTAATAAAGATAGAAAA AGG (reversed) Intergenic
No off target data available for this crispr