ID: 1009717115

View in Genome Browser
Species Human (GRCh38)
Location 6:67412144-67412166
Sequence TAAAATGTTATAAAATGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009717111_1009717115 12 Left 1009717111 6:67412109-67412131 CCTTTTTCTATCTTTATTAGCCC No data
Right 1009717115 6:67412144-67412166 TAAAATGTTATAAAATGCAAAGG No data
1009717112_1009717115 -8 Left 1009717112 6:67412129-67412151 CCCACACCTTAAGATTAAAATGT No data
Right 1009717115 6:67412144-67412166 TAAAATGTTATAAAATGCAAAGG No data
1009717113_1009717115 -9 Left 1009717113 6:67412130-67412152 CCACACCTTAAGATTAAAATGTT No data
Right 1009717115 6:67412144-67412166 TAAAATGTTATAAAATGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009717115 Original CRISPR TAAAATGTTATAAAATGCAA AGG Intergenic
No off target data available for this crispr