ID: 1009717116

View in Genome Browser
Species Human (GRCh38)
Location 6:67412148-67412170
Sequence ATGTTATAAAATGCAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009717111_1009717116 16 Left 1009717111 6:67412109-67412131 CCTTTTTCTATCTTTATTAGCCC No data
Right 1009717116 6:67412148-67412170 ATGTTATAAAATGCAAAGGAAGG No data
1009717113_1009717116 -5 Left 1009717113 6:67412130-67412152 CCACACCTTAAGATTAAAATGTT No data
Right 1009717116 6:67412148-67412170 ATGTTATAAAATGCAAAGGAAGG No data
1009717114_1009717116 -10 Left 1009717114 6:67412135-67412157 CCTTAAGATTAAAATGTTATAAA No data
Right 1009717116 6:67412148-67412170 ATGTTATAAAATGCAAAGGAAGG No data
1009717112_1009717116 -4 Left 1009717112 6:67412129-67412151 CCCACACCTTAAGATTAAAATGT No data
Right 1009717116 6:67412148-67412170 ATGTTATAAAATGCAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009717116 Original CRISPR ATGTTATAAAATGCAAAGGA AGG Intergenic
No off target data available for this crispr