ID: 1009718335

View in Genome Browser
Species Human (GRCh38)
Location 6:67428676-67428698
Sequence GAGGGCGAACAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009718335_1009718345 24 Left 1009718335 6:67428676-67428698 CCATCCTGCTTCTGTTCGCCCTC No data
Right 1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG No data
1009718335_1009718344 23 Left 1009718335 6:67428676-67428698 CCATCCTGCTTCTGTTCGCCCTC No data
Right 1009718344 6:67428722-67428744 CCAGTCCCAATGAAATGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009718335 Original CRISPR GAGGGCGAACAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr