ID: 1009718345

View in Genome Browser
Species Human (GRCh38)
Location 6:67428723-67428745
Sequence CAGTCCCAATGAAATGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009718335_1009718345 24 Left 1009718335 6:67428676-67428698 CCATCCTGCTTCTGTTCGCCCTC No data
Right 1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG No data
1009718339_1009718345 6 Left 1009718339 6:67428694-67428716 CCCTCTGTGGGCTGCACCCACTG 0: 360
1: 628
2: 956
3: 647
4: 577
Right 1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG No data
1009718340_1009718345 5 Left 1009718340 6:67428695-67428717 CCTCTGTGGGCTGCACCCACTGT 0: 351
1: 601
2: 921
3: 663
4: 526
Right 1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG No data
1009718341_1009718345 -10 Left 1009718341 6:67428710-67428732 CCCACTGTCTAACCAGTCCCAAT 0: 312
1: 897
2: 1012
3: 651
4: 806
Right 1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG No data
1009718336_1009718345 20 Left 1009718336 6:67428680-67428702 CCTGCTTCTGTTCGCCCTCTGTG No data
Right 1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG No data
1009718334_1009718345 25 Left 1009718334 6:67428675-67428697 CCCATCCTGCTTCTGTTCGCCCT No data
Right 1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG No data
1009718333_1009718345 26 Left 1009718333 6:67428674-67428696 CCCCATCCTGCTTCTGTTCGCCC No data
Right 1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009718345 Original CRISPR CAGTCCCAATGAAATGAAAC GGG Intergenic
No off target data available for this crispr