ID: 1009719477

View in Genome Browser
Species Human (GRCh38)
Location 6:67448595-67448617
Sequence ATGGTAAACAAATGTAGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009719477_1009719482 20 Left 1009719477 6:67448595-67448617 CCACTACTACATTTGTTTACCAT No data
Right 1009719482 6:67448638-67448660 CCGGACTTTCACTCCTTAGTTGG No data
1009719477_1009719479 1 Left 1009719477 6:67448595-67448617 CCACTACTACATTTGTTTACCAT No data
Right 1009719479 6:67448619-67448641 CTTGAATCCTAACTAAAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009719477 Original CRISPR ATGGTAAACAAATGTAGTAG TGG (reversed) Intergenic
No off target data available for this crispr