ID: 1009719478

View in Genome Browser
Species Human (GRCh38)
Location 6:67448614-67448636
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009719478_1009719482 1 Left 1009719478 6:67448614-67448636 CCATTCTTGAATCCTAACTAAAA No data
Right 1009719482 6:67448638-67448660 CCGGACTTTCACTCCTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009719478 Original CRISPR TTTTAGTTAGGATTCAAGAA TGG (reversed) Intergenic
No off target data available for this crispr