ID: 1009719479

View in Genome Browser
Species Human (GRCh38)
Location 6:67448619-67448641
Sequence CTTGAATCCTAACTAAAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009719477_1009719479 1 Left 1009719477 6:67448595-67448617 CCACTACTACATTTGTTTACCAT No data
Right 1009719479 6:67448619-67448641 CTTGAATCCTAACTAAAAACCGG No data
1009719476_1009719479 9 Left 1009719476 6:67448587-67448609 CCAATTTACCACTACTACATTTG No data
Right 1009719479 6:67448619-67448641 CTTGAATCCTAACTAAAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009719479 Original CRISPR CTTGAATCCTAACTAAAAAC CGG Intergenic
No off target data available for this crispr