ID: 1009721524

View in Genome Browser
Species Human (GRCh38)
Location 6:67476788-67476810
Sequence GGGGTACTTACTTGGCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009721517_1009721524 17 Left 1009721517 6:67476748-67476770 CCCTAGGAACAAAGGGCTATCCA No data
Right 1009721524 6:67476788-67476810 GGGGTACTTACTTGGCAGTTTGG No data
1009721518_1009721524 16 Left 1009721518 6:67476749-67476771 CCTAGGAACAAAGGGCTATCCAT No data
Right 1009721524 6:67476788-67476810 GGGGTACTTACTTGGCAGTTTGG No data
1009721520_1009721524 -3 Left 1009721520 6:67476768-67476790 CCATGTTTGTTAAATATCTAGGG No data
Right 1009721524 6:67476788-67476810 GGGGTACTTACTTGGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009721524 Original CRISPR GGGGTACTTACTTGGCAGTT TGG Intergenic
No off target data available for this crispr