ID: 1009727707

View in Genome Browser
Species Human (GRCh38)
Location 6:67556953-67556975
Sequence CTGGGAGAATGGAAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009727707_1009727712 12 Left 1009727707 6:67556953-67556975 CCAACTTGCTTCCATTCTCCCAG No data
Right 1009727712 6:67556988-67557010 ACACCAATCAAATGTAGATTTGG 0: 324
1: 1670
2: 4191
3: 2462
4: 1296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009727707 Original CRISPR CTGGGAGAATGGAAGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr