ID: 1009727707 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:67556953-67556975 |
| Sequence | CTGGGAGAATGGAAGCAAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1009727707_1009727712 | 12 | Left | 1009727707 | 6:67556953-67556975 | CCAACTTGCTTCCATTCTCCCAG | No data | ||
| Right | 1009727712 | 6:67556988-67557010 | ACACCAATCAAATGTAGATTTGG | 0: 324 1: 1670 2: 4191 3: 2462 4: 1296 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1009727707 | Original CRISPR | CTGGGAGAATGGAAGCAAGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||