ID: 1009728137

View in Genome Browser
Species Human (GRCh38)
Location 6:67560547-67560569
Sequence AGGGAGAGCAAAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009728137_1009728144 25 Left 1009728137 6:67560547-67560569 CCCACAATCACTTTGCTCTCCCT No data
Right 1009728144 6:67560595-67560617 TCCACTGCCAAGGGATTAGAAGG No data
1009728137_1009728147 27 Left 1009728137 6:67560547-67560569 CCCACAATCACTTTGCTCTCCCT No data
Right 1009728147 6:67560597-67560619 CACTGCCAAGGGATTAGAAGGGG No data
1009728137_1009728146 26 Left 1009728137 6:67560547-67560569 CCCACAATCACTTTGCTCTCCCT No data
Right 1009728146 6:67560596-67560618 CCACTGCCAAGGGATTAGAAGGG No data
1009728137_1009728143 16 Left 1009728137 6:67560547-67560569 CCCACAATCACTTTGCTCTCCCT No data
Right 1009728143 6:67560586-67560608 ATCTCTCTGTCCACTGCCAAGGG No data
1009728137_1009728142 15 Left 1009728137 6:67560547-67560569 CCCACAATCACTTTGCTCTCCCT No data
Right 1009728142 6:67560585-67560607 AATCTCTCTGTCCACTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009728137 Original CRISPR AGGGAGAGCAAAGTGATTGT GGG (reversed) Intergenic