ID: 1009735327

View in Genome Browser
Species Human (GRCh38)
Location 6:67669758-67669780
Sequence GAGAGGAAAATGATAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009735327_1009735332 17 Left 1009735327 6:67669758-67669780 CCTGCCTCTATCATTTTCCTCTC No data
Right 1009735332 6:67669798-67669820 CTGCAATTAGAATAAAGATAGGG No data
1009735327_1009735333 23 Left 1009735327 6:67669758-67669780 CCTGCCTCTATCATTTTCCTCTC No data
Right 1009735333 6:67669804-67669826 TTAGAATAAAGATAGGGATAAGG No data
1009735327_1009735331 16 Left 1009735327 6:67669758-67669780 CCTGCCTCTATCATTTTCCTCTC No data
Right 1009735331 6:67669797-67669819 ACTGCAATTAGAATAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009735327 Original CRISPR GAGAGGAAAATGATAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr