ID: 1009736316

View in Genome Browser
Species Human (GRCh38)
Location 6:67680511-67680533
Sequence TTGTAGTTAAGGAGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009736316_1009736320 19 Left 1009736316 6:67680511-67680533 CCAGCTCCACTCCTTAACTACAA No data
Right 1009736320 6:67680553-67680575 CTTTATTACCCTACCTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009736316 Original CRISPR TTGTAGTTAAGGAGTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr