ID: 1009740501

View in Genome Browser
Species Human (GRCh38)
Location 6:67737430-67737452
Sequence CTTATCTAAGCCATAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009740501_1009740505 9 Left 1009740501 6:67737430-67737452 CCTTTCCTTATGGCTTAGATAAG No data
Right 1009740505 6:67737462-67737484 AGGTGTGTCACTTTATTTCTGGG No data
1009740501_1009740506 30 Left 1009740501 6:67737430-67737452 CCTTTCCTTATGGCTTAGATAAG No data
Right 1009740506 6:67737483-67737505 GGACCTCTCTTCTATTCTACTGG No data
1009740501_1009740504 8 Left 1009740501 6:67737430-67737452 CCTTTCCTTATGGCTTAGATAAG No data
Right 1009740504 6:67737461-67737483 TAGGTGTGTCACTTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009740501 Original CRISPR CTTATCTAAGCCATAAGGAA AGG (reversed) Intergenic
No off target data available for this crispr