ID: 1009741401

View in Genome Browser
Species Human (GRCh38)
Location 6:67751436-67751458
Sequence TGTTGTGTATGGTGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009741395_1009741401 3 Left 1009741395 6:67751410-67751432 CCTTGGCAGATAAATTGATTTTG No data
Right 1009741401 6:67751436-67751458 TGTTGTGTATGGTGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009741401 Original CRISPR TGTTGTGTATGGTGGGCAGA GGG Intergenic
No off target data available for this crispr