ID: 1009751946

View in Genome Browser
Species Human (GRCh38)
Location 6:67886431-67886453
Sequence GAGTTGTAAGGGAAGTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009751940_1009751946 4 Left 1009751940 6:67886404-67886426 CCTGGTTTTTGAACAGGTAGGAT No data
Right 1009751946 6:67886431-67886453 GAGTTGTAAGGGAAGTTGGTAGG No data
1009751937_1009751946 17 Left 1009751937 6:67886391-67886413 CCTGTACGACTTACCTGGTTTTT No data
Right 1009751946 6:67886431-67886453 GAGTTGTAAGGGAAGTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009751946 Original CRISPR GAGTTGTAAGGGAAGTTGGT AGG Intergenic
No off target data available for this crispr