ID: 1009758669

View in Genome Browser
Species Human (GRCh38)
Location 6:67975874-67975896
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009758667_1009758669 20 Left 1009758667 6:67975831-67975853 CCATTGCATAACTTGGTCATCTT No data
Right 1009758669 6:67975874-67975896 ATGTTCTAGGAAAAGTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009758669 Original CRISPR ATGTTCTAGGAAAAGTGTTA AGG Intergenic
No off target data available for this crispr