ID: 1009759890

View in Genome Browser
Species Human (GRCh38)
Location 6:67991866-67991888
Sequence TCCTCAAGTGAGTCTCCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009759890_1009759893 9 Left 1009759890 6:67991866-67991888 CCGACAGGAGACTCACTTGAGGA No data
Right 1009759893 6:67991898-67991920 GAGATCAGCCTGGGCAACATAGG 0: 118
1: 2012
2: 6291
3: 8017
4: 6586
1009759890_1009759892 0 Left 1009759890 6:67991866-67991888 CCGACAGGAGACTCACTTGAGGA No data
Right 1009759892 6:67991889-67991911 CAGAAATTTGAGATCAGCCTGGG 0: 10
1: 424
2: 5509
3: 30695
4: 49252
1009759890_1009759891 -1 Left 1009759890 6:67991866-67991888 CCGACAGGAGACTCACTTGAGGA No data
Right 1009759891 6:67991888-67991910 ACAGAAATTTGAGATCAGCCTGG No data
1009759890_1009759894 10 Left 1009759890 6:67991866-67991888 CCGACAGGAGACTCACTTGAGGA No data
Right 1009759894 6:67991899-67991921 AGATCAGCCTGGGCAACATAGGG 0: 168
1: 2653
2: 5347
3: 7272
4: 8756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009759890 Original CRISPR TCCTCAAGTGAGTCTCCTGT CGG (reversed) Intergenic
No off target data available for this crispr