ID: 1009763487

View in Genome Browser
Species Human (GRCh38)
Location 6:68038596-68038618
Sequence CACAGAGTCAAAGGAGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009763487_1009763497 12 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763497 6:68038631-68038653 GGCAGGCTAATGCAAGGGGTGGG No data
1009763487_1009763498 27 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763498 6:68038646-68038668 GGGGTGGGCTCCCACACCCTCGG No data
1009763487_1009763496 11 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763496 6:68038630-68038652 GGGCAGGCTAATGCAAGGGGTGG No data
1009763487_1009763495 8 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763495 6:68038627-68038649 CCAGGGCAGGCTAATGCAAGGGG No data
1009763487_1009763489 -10 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763489 6:68038609-68038631 TGACTCTGTGTCTCATATCCAGG No data
1009763487_1009763492 6 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763492 6:68038625-68038647 ATCCAGGGCAGGCTAATGCAAGG No data
1009763487_1009763491 -5 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763491 6:68038614-68038636 CTGTGTCTCATATCCAGGGCAGG No data
1009763487_1009763493 7 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763493 6:68038626-68038648 TCCAGGGCAGGCTAATGCAAGGG No data
1009763487_1009763499 28 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763499 6:68038647-68038669 GGGTGGGCTCCCACACCCTCGGG No data
1009763487_1009763490 -9 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763490 6:68038610-68038632 GACTCTGTGTCTCATATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009763487 Original CRISPR CACAGAGTCAAAGGAGATTT TGG (reversed) Intergenic
No off target data available for this crispr