ID: 1009763488

View in Genome Browser
Species Human (GRCh38)
Location 6:68038605-68038627
Sequence GATATGAGACACAGAGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009763488_1009763493 -2 Left 1009763488 6:68038605-68038627 CCTTTGACTCTGTGTCTCATATC No data
Right 1009763493 6:68038626-68038648 TCCAGGGCAGGCTAATGCAAGGG No data
1009763488_1009763497 3 Left 1009763488 6:68038605-68038627 CCTTTGACTCTGTGTCTCATATC No data
Right 1009763497 6:68038631-68038653 GGCAGGCTAATGCAAGGGGTGGG No data
1009763488_1009763495 -1 Left 1009763488 6:68038605-68038627 CCTTTGACTCTGTGTCTCATATC No data
Right 1009763495 6:68038627-68038649 CCAGGGCAGGCTAATGCAAGGGG No data
1009763488_1009763499 19 Left 1009763488 6:68038605-68038627 CCTTTGACTCTGTGTCTCATATC No data
Right 1009763499 6:68038647-68038669 GGGTGGGCTCCCACACCCTCGGG No data
1009763488_1009763496 2 Left 1009763488 6:68038605-68038627 CCTTTGACTCTGTGTCTCATATC No data
Right 1009763496 6:68038630-68038652 GGGCAGGCTAATGCAAGGGGTGG No data
1009763488_1009763492 -3 Left 1009763488 6:68038605-68038627 CCTTTGACTCTGTGTCTCATATC No data
Right 1009763492 6:68038625-68038647 ATCCAGGGCAGGCTAATGCAAGG No data
1009763488_1009763498 18 Left 1009763488 6:68038605-68038627 CCTTTGACTCTGTGTCTCATATC No data
Right 1009763498 6:68038646-68038668 GGGGTGGGCTCCCACACCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009763488 Original CRISPR GATATGAGACACAGAGTCAA AGG (reversed) Intergenic
No off target data available for this crispr