ID: 1009763490

View in Genome Browser
Species Human (GRCh38)
Location 6:68038610-68038632
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009763485_1009763490 22 Left 1009763485 6:68038565-68038587 CCCAGCTGTGCAGTCATTAAATC No data
Right 1009763490 6:68038610-68038632 GACTCTGTGTCTCATATCCAGGG No data
1009763487_1009763490 -9 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763490 6:68038610-68038632 GACTCTGTGTCTCATATCCAGGG No data
1009763486_1009763490 21 Left 1009763486 6:68038566-68038588 CCAGCTGTGCAGTCATTAAATCT No data
Right 1009763490 6:68038610-68038632 GACTCTGTGTCTCATATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009763490 Original CRISPR GACTCTGTGTCTCATATCCA GGG Intergenic