ID: 1009763496

View in Genome Browser
Species Human (GRCh38)
Location 6:68038630-68038652
Sequence GGGCAGGCTAATGCAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009763488_1009763496 2 Left 1009763488 6:68038605-68038627 CCTTTGACTCTGTGTCTCATATC No data
Right 1009763496 6:68038630-68038652 GGGCAGGCTAATGCAAGGGGTGG No data
1009763487_1009763496 11 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763496 6:68038630-68038652 GGGCAGGCTAATGCAAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009763496 Original CRISPR GGGCAGGCTAATGCAAGGGG TGG Intergenic
No off target data available for this crispr