ID: 1009763497 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:68038631-68038653 |
Sequence | GGCAGGCTAATGCAAGGGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1009763487_1009763497 | 12 | Left | 1009763487 | 6:68038596-68038618 | CCAAAATCTCCTTTGACTCTGTG | No data | ||
Right | 1009763497 | 6:68038631-68038653 | GGCAGGCTAATGCAAGGGGTGGG | No data | ||||
1009763488_1009763497 | 3 | Left | 1009763488 | 6:68038605-68038627 | CCTTTGACTCTGTGTCTCATATC | No data | ||
Right | 1009763497 | 6:68038631-68038653 | GGCAGGCTAATGCAAGGGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1009763497 | Original CRISPR | GGCAGGCTAATGCAAGGGGT GGG | Intergenic | ||