ID: 1009763499

View in Genome Browser
Species Human (GRCh38)
Location 6:68038647-68038669
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009763494_1009763499 -3 Left 1009763494 6:68038627-68038649 CCAGGGCAGGCTAATGCAAGGGG No data
Right 1009763499 6:68038647-68038669 GGGTGGGCTCCCACACCCTCGGG No data
1009763488_1009763499 19 Left 1009763488 6:68038605-68038627 CCTTTGACTCTGTGTCTCATATC No data
Right 1009763499 6:68038647-68038669 GGGTGGGCTCCCACACCCTCGGG No data
1009763487_1009763499 28 Left 1009763487 6:68038596-68038618 CCAAAATCTCCTTTGACTCTGTG No data
Right 1009763499 6:68038647-68038669 GGGTGGGCTCCCACACCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009763499 Original CRISPR GGGTGGGCTCCCACACCCTC GGG Intergenic