ID: 1009764122

View in Genome Browser
Species Human (GRCh38)
Location 6:68047104-68047126
Sequence CTGAAGTTCTTTATAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009764121_1009764122 19 Left 1009764121 6:68047062-68047084 CCACTTTTTTATGGGGTTGTTTG 0: 42
1: 11141
2: 10075
3: 7519
4: 6324
Right 1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG No data
1009764119_1009764122 25 Left 1009764119 6:68047056-68047078 CCTTGCCCACTTTTTTATGGGGT No data
Right 1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG No data
1009764117_1009764122 26 Left 1009764117 6:68047055-68047077 CCCTTGCCCACTTTTTTATGGGG 0: 69
1: 7261
2: 10529
3: 9308
4: 6612
Right 1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG No data
1009764120_1009764122 20 Left 1009764120 6:68047061-68047083 CCCACTTTTTTATGGGGTTGTTT 0: 71
1: 14353
2: 10066
3: 6730
4: 5558
Right 1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009764122 Original CRISPR CTGAAGTTCTTTATAGAAGA TGG Intergenic
No off target data available for this crispr