ID: 1009764938

View in Genome Browser
Species Human (GRCh38)
Location 6:68060166-68060188
Sequence CTGGAGACAAACTTGGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009764932_1009764938 15 Left 1009764932 6:68060128-68060150 CCTGTTGAAAAGAGAACAAAACC 0: 1
1: 0
2: 2
3: 32
4: 349
Right 1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG 0: 1
1: 0
2: 0
3: 11
4: 141
1009764936_1009764938 -7 Left 1009764936 6:68060150-68060172 CCTCAACAAGGAGCAGCTGGAGA 0: 1
1: 0
2: 5
3: 28
4: 246
Right 1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG 0: 1
1: 0
2: 0
3: 11
4: 141
1009764935_1009764938 -6 Left 1009764935 6:68060149-68060171 CCCTCAACAAGGAGCAGCTGGAG 0: 1
1: 1
2: 2
3: 23
4: 303
Right 1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009764938 Original CRISPR CTGGAGACAAACTTGGAGCG AGG Intergenic
900861460 1:5235715-5235737 CTGGAGCCCAACTGGGAGAGGGG + Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
905380214 1:37556667-37556689 CAGGTGACAAAATTGGAGCATGG + Intergenic
911361815 1:96885982-96886004 CTAGAGAAAAACCTGGAGCAGGG - Intergenic
913200219 1:116489931-116489953 CAGGATTCAAACTTGGATCGAGG + Intergenic
914909627 1:151774061-151774083 GGGGAGACACACTTGTAGCGTGG + Exonic
915014263 1:152718772-152718794 CTGGTGGGAAACTTGGAGCCTGG + Intergenic
915793182 1:158697561-158697583 CTGAAGAGAAACTTGGAGTCTGG + Intergenic
919481918 1:198100420-198100442 CTGGAGACAAACTGAGGGCTTGG + Intergenic
920937735 1:210451151-210451173 CTGCAGAGAAGCTTGGAGCTTGG + Intronic
922575388 1:226657951-226657973 CTGGGAACAGACTTGGAGGGAGG - Intronic
923552721 1:234977036-234977058 CTAAAAACAAACTTGGAGAGTGG + Intergenic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1063703211 10:8405777-8405799 CTTGGGACACACTTGGAGGGAGG + Intergenic
1069326980 10:67243173-67243195 CTGGAGAGAAACATGGGGAGTGG - Intronic
1071396403 10:85228170-85228192 CTGGAGAAAACCTTGGTGCCAGG + Intergenic
1071530509 10:86387762-86387784 CTGGAGAAAAACCAGGAGGGTGG - Intergenic
1075038701 10:119090499-119090521 CAGGAGACCAACATGGAGAGAGG - Intergenic
1079770170 11:24448449-24448471 GTAGAGACAAACTTTGAGCTGGG + Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1081625423 11:44652466-44652488 CTGGAGACAGGTTTGGAGGGTGG + Intergenic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1082214836 11:49557173-49557195 ATGGAGAAAAACTGGGAGCTTGG + Intergenic
1084349568 11:68586184-68586206 CTGTAGATAAACTCAGAGCGTGG + Intronic
1086634748 11:89067293-89067315 TTGGAGAAAAACTGGGAGCTTGG - Intergenic
1087846938 11:102984081-102984103 CTGGAGACAAAACTTGAGAGTGG + Intergenic
1089320246 11:117621135-117621157 ATGGAGGCAAATTTGGAGCTGGG - Intronic
1089474100 11:118744361-118744383 CTAGAGACAATCTTGCAGGGAGG + Intergenic
1090410957 11:126509350-126509372 CTGAAGCCAAGCTTGGAGGGTGG - Intronic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1097218153 12:57430513-57430535 CTGGAGAGAAGCTGGGGGCGCGG - Intronic
1098578066 12:72066921-72066943 CTGGTGACCACCTTGGAGCCAGG + Intronic
1098806771 12:75030443-75030465 ATGGAGACAAAATTGAAGCATGG + Intergenic
1103160314 12:118723689-118723711 CTGGAGAAACACTGGGAGCCAGG + Intergenic
1103193695 12:119024276-119024298 CTCGGGAAAAACTTGGAGCTGGG - Intronic
1103526457 12:121572424-121572446 CGGGGGATAAACTTGGAGTGCGG - Intronic
1109940092 13:69350440-69350462 CTGGAGAGAAATCTGGAGCTGGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1114717865 14:24846520-24846542 CTGGCTACAAACTGGGAGAGTGG + Intronic
1116271756 14:42779410-42779432 CTAGAGAGAAATTTGGAGTGTGG - Intergenic
1121545170 14:94757906-94757928 CTGGAGAGCAACATGGAGCATGG + Intergenic
1122164117 14:99808268-99808290 CTGGAGACAAACTCCCTGCGAGG - Intronic
1122689429 14:103524743-103524765 CTGGAGGCAGACTTGGGGGGAGG + Intergenic
1122798863 14:104219983-104220005 CTGGAGTCAGACATGGTGCGGGG + Intergenic
1131274679 15:90971134-90971156 CTGGGGGCAAACTAGGAGCCAGG + Intronic
1134797647 16:17056695-17056717 CTGGAGACAAGCCTGGAGCCTGG + Intergenic
1135007589 16:18840841-18840863 CTTGAGACAAATTTGGAGAGGGG - Intronic
1135869232 16:26134131-26134153 CTGGAGGCAAACTCGGATGGAGG + Intronic
1138423207 16:56913186-56913208 CTGAAAACAAACTGGGAGCTGGG + Intronic
1143410707 17:6706767-6706789 CTGGACACACACCTGGAGCGTGG + Exonic
1151210230 17:72538936-72538958 CTGGAGAGAAACTGGGAGGAGGG + Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154459949 18:14572914-14572936 CTGTAGACAAACATGGACCCTGG + Intergenic
1156317951 18:35988473-35988495 TTGGAGTCAAACTTGGAGCCAGG + Intronic
1157119303 18:44894184-44894206 CTGGCGAACAACTTGGAGAGAGG - Intronic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157274238 18:46298846-46298868 CTGGAGAGAGTCATGGAGCGGGG + Intergenic
1162897625 19:13774824-13774846 CTGGGGACGAGCTAGGAGCGAGG + Intronic
1162937261 19:13987407-13987429 CTGGACCCAGACTTGGAGCCTGG - Intronic
1164207379 19:23070270-23070292 GTGGAAACAAACTTGAAGTGGGG + Intergenic
1166081131 19:40444584-40444606 ATGGTGACGATCTTGGAGCGAGG - Exonic
1166374667 19:42320949-42320971 CAGGACACAAAGTTGGAGAGGGG - Intronic
1167157969 19:47750735-47750757 CTGGAGACAGACGTGGGGAGAGG + Intronic
1167794203 19:51698655-51698677 CTGGATATACACTTGGAGAGAGG - Intergenic
1168402145 19:56091583-56091605 CTAGAGGCAAACTGGGAGTGGGG + Intronic
926310193 2:11669506-11669528 CTGGATAAAGACTTGGAGCGCGG + Exonic
926377903 2:12252379-12252401 TTGGAGACAAACTTGTATCCAGG - Intergenic
926444134 2:12923254-12923276 CTGGAGATAAGATTGGAGGGGGG + Intergenic
927113745 2:19882578-19882600 TTGGAGACAAACAAGGAGTGAGG - Intergenic
928221428 2:29406434-29406456 CTGAAGGCAAACTTGGAGACAGG - Intronic
930741396 2:54836130-54836152 CTGGAGACAGATTTGCAGCCAGG + Intronic
930906505 2:56574771-56574793 ATGAAGACAAACTGGGAGCAGGG - Intergenic
932001457 2:67888924-67888946 GTTGAGGCAAACTTGGAGCTGGG - Intergenic
938694078 2:133819590-133819612 ATGGAGACAAGCTTGGCGCTGGG - Intergenic
938777454 2:134554471-134554493 GTGGAGACAGACTGGGAGCCCGG - Intronic
943643784 2:190386714-190386736 CTGGAGTCTAACTGGGAGCCAGG - Intergenic
945416493 2:209579357-209579379 CTGGGGACACACTTGGATGGAGG + Intronic
1174406065 20:50304236-50304258 CTGGAGCAAGACTTGGAGGGTGG + Intergenic
1174925159 20:54751049-54751071 CTGGAAACAGACTTTGAGGGAGG - Intergenic
1176659456 21:9620882-9620904 TTGGAGAGAAGCTTGGAGTGTGG + Intergenic
1176659476 21:9621022-9621044 TTGGAGAGAAGCTTGGAGTGTGG + Intergenic
1176814166 21:13579914-13579936 CTGTAGACAAACATGGACCCTGG - Intergenic
1178678775 21:34653975-34653997 CTAGAGACAAGCATGGAGCAGGG + Intergenic
1179147075 21:38777391-38777413 ATGGAGACAAGATTGGAGCCTGG - Intergenic
1181856147 22:25782867-25782889 CTGTAGAAGAACTTGGAGTGGGG + Intronic
1183370266 22:37427909-37427931 CTGGGGGCAAACTTGCGGCGGGG + Intergenic
1184812917 22:46849235-46849257 CTGGAGACCCACTTGGACGGAGG - Intronic
953247062 3:41203091-41203113 CTTGAGGGAAACTTGGAGAGTGG - Intronic
953836628 3:46351786-46351808 GTGAAGACAAAATTGGAGAGCGG + Intergenic
956705048 3:71992435-71992457 CTGGAGACCTAATTGGAGCTGGG + Intergenic
958924620 3:100144506-100144528 TTGGAGACAAACTGGGAGCTGGG - Intronic
963470312 3:145732519-145732541 ATGCAGACAAAATTGGAGAGAGG + Intergenic
969703576 4:8780549-8780571 GTGCAGAAACACTTGGAGCGTGG + Intergenic
971765568 4:30826437-30826459 CTGGAGACTCAGTTGGACCGAGG - Intronic
982561097 4:156928632-156928654 CTGGAGACAAGTATAGAGCGTGG - Intronic
983732042 4:171007883-171007905 CTGGAGACCATGTTGGAGCTTGG + Intergenic
985415867 4:189735216-189735238 TTGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415899 4:189735426-189735448 CAGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415904 4:189735460-189735482 CAGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415909 4:189735494-189735516 CAGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415914 4:189735528-189735550 CAGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415919 4:189735562-189735584 CAGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415936 4:189735665-189735687 CAGGAGAGAAACTTGGAGTGTGG - Intergenic
985415941 4:189735699-189735721 CAGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415946 4:189735733-189735755 TTGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415963 4:189735838-189735860 TTGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415968 4:189735873-189735895 CAGGAGAGAAGCTTGGAGTGTGG - Intergenic
985415999 4:189736047-189736069 TTGGAGAGAAGCTTGGAGTGTGG - Intergenic
985416004 4:189736082-189736104 TTGGAGAGAAGCTTGGAGTGTGG - Intergenic
985416009 4:189736117-189736139 TTGGAGAGAAGCTTGGAGTGTGG - Intergenic
985416014 4:189736152-189736174 TTGGAGAGAAGCTTGGAGTGTGG - Intergenic
985416019 4:189736187-189736209 TTGGAGAGAAGCTTGGAGTGTGG - Intergenic
985416024 4:189736222-189736244 TTGGAGAGAAGCTTGGAGTGTGG - Intergenic
985416035 4:189736292-189736314 CAGGAGAGAAGCTTGGAGTGTGG - Intergenic
987258119 5:16178933-16178955 CTGGAGGCAAACTGGGAGGTAGG + Intronic
989746507 5:44836048-44836070 CTGGAGAGGAGATTGGAGCGTGG + Intergenic
990982547 5:61615077-61615099 CTGGAGACAAGCTTGGAAACTGG + Intergenic
992171624 5:74107557-74107579 CTGGAGACAGACTTGGTTTGGGG - Intergenic
994921794 5:106054673-106054695 CTGTAGACATACTTGGAACCAGG + Intergenic
997601419 5:135141228-135141250 CTGGAGACCAAGGTGGAGCCAGG - Intronic
998224365 5:140315099-140315121 CAGGAGACAAATTTGGAGTCAGG + Intergenic
1005021725 6:21424759-21424781 ATGAAGACAAACTTGGAGACTGG - Intergenic
1007517648 6:42425910-42425932 GTGGAGCAAAACTTGGAGCCTGG - Intronic
1008000654 6:46356430-46356452 CTGGAGGGAAACCTGGAGGGTGG + Intronic
1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG + Intergenic
1010144796 6:72655575-72655597 ATGGAGACAAGCTTGGTGTGTGG + Intronic
1011382307 6:86755916-86755938 CTGGAGAGAAACTGGGACTGGGG - Intergenic
1016830985 6:148432772-148432794 GTGGAGACAAAGTGGGAGTGGGG + Intronic
1021243239 7:18231049-18231071 CTGGGGACAAGCTTAGAGCGAGG + Intronic
1022228473 7:28388592-28388614 CTGGAGAAATACTTGGAACTAGG - Intronic
1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG + Intergenic
1030179989 7:106696604-106696626 CTGGAGCCAAGCTTGGAGGCAGG - Intergenic
1034066804 7:148144794-148144816 CTGGAGACACACATTAAGCGAGG + Intronic
1034503886 7:151469967-151469989 CGGGAGACAAGCTTGGTGCCGGG + Intronic
1035396724 7:158539830-158539852 CTGGAGACATACTGTGAGCCTGG + Intronic
1042125174 8:65531006-65531028 CTGCAGAAAAACTCAGAGCGAGG - Intergenic
1042717792 8:71793763-71793785 GTGGAGACAGACTTGGAGTTTGG - Intergenic
1049562085 8:143316984-143317006 CTGGGGACAACCTTGGAGCTGGG - Intronic
1057250995 9:93501720-93501742 CAGGAGACAAGCCTGGAGAGAGG + Intronic
1059098811 9:111449719-111449741 CTGGAGAAAGACTTGGAGTAGGG - Intronic
1059566277 9:115385746-115385768 CTTGATACAATCTTGGAGCCGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061149938 9:128822884-128822906 CTGAAGACAGGCTGGGAGCGGGG - Intronic
1062707046 9:137951520-137951542 CTGGAGAGAAACCAGGAGGGTGG - Intronic
1203637018 Un_KI270750v1:122725-122747 TTGGAGAGAAGCTTGGAGTGTGG + Intergenic
1203637038 Un_KI270750v1:122865-122887 TTGGAGAGAAGCTTGGAGTGTGG + Intergenic
1187166437 X:16808535-16808557 CTGGAGACAAACTGGGTGAGTGG - Intronic
1192216381 X:69162252-69162274 CTGAAGACAAACGGGAAGCGAGG - Exonic
1193144140 X:78059970-78059992 CTGGAGAAATACCTGGAGGGAGG - Intergenic
1196066212 X:111467536-111467558 CTGGGGCCAAAGTTGGAGAGGGG + Intergenic
1196850120 X:119929624-119929646 CTGAAGACAAACTTGTAACCAGG + Intronic
1198384834 X:136118748-136118770 CTGGATCCAACCTTGGAGAGTGG - Intergenic
1198759869 X:140020681-140020703 CTGGAGACAAATTTGAGTCGAGG + Intergenic