ID: 1009771321

View in Genome Browser
Species Human (GRCh38)
Location 6:68145810-68145832
Sequence CAGCTGACACCCACCCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009771321_1009771323 11 Left 1009771321 6:68145810-68145832 CCTCTATGGGTGGGTGTCAGCTG No data
Right 1009771323 6:68145844-68145866 GTTTTTCTTTCTGCTATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009771321 Original CRISPR CAGCTGACACCCACCCATAG AGG (reversed) Intergenic
No off target data available for this crispr