ID: 1009782006

View in Genome Browser
Species Human (GRCh38)
Location 6:68283869-68283891
Sequence ACATTGGTGTGGAGCCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009782003_1009782006 14 Left 1009782003 6:68283832-68283854 CCAAAGAAGTGAAGATATTTACA No data
Right 1009782006 6:68283869-68283891 ACATTGGTGTGGAGCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009782006 Original CRISPR ACATTGGTGTGGAGCCAAGA TGG Intergenic
No off target data available for this crispr