ID: 1009787645

View in Genome Browser
Species Human (GRCh38)
Location 6:68359368-68359390
Sequence ATTGGGCATCTGAACAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009787645_1009787651 26 Left 1009787645 6:68359368-68359390 CCTGGGTTGTTCAGATGCCCAAT No data
Right 1009787651 6:68359417-68359439 CTCTGCCTCTCTCACATACTGGG No data
1009787645_1009787650 25 Left 1009787645 6:68359368-68359390 CCTGGGTTGTTCAGATGCCCAAT No data
Right 1009787650 6:68359416-68359438 TCTCTGCCTCTCTCACATACTGG No data
1009787645_1009787649 -2 Left 1009787645 6:68359368-68359390 CCTGGGTTGTTCAGATGCCCAAT No data
Right 1009787649 6:68359389-68359411 ATGAAAAGATGAGTCACAGAGGG No data
1009787645_1009787648 -3 Left 1009787645 6:68359368-68359390 CCTGGGTTGTTCAGATGCCCAAT No data
Right 1009787648 6:68359388-68359410 AATGAAAAGATGAGTCACAGAGG No data
1009787645_1009787652 27 Left 1009787645 6:68359368-68359390 CCTGGGTTGTTCAGATGCCCAAT No data
Right 1009787652 6:68359418-68359440 TCTGCCTCTCTCACATACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009787645 Original CRISPR ATTGGGCATCTGAACAACCC AGG (reversed) Intergenic
No off target data available for this crispr