ID: 1009788905

View in Genome Browser
Species Human (GRCh38)
Location 6:68374143-68374165
Sequence GTATCTTTTAAGGTTATTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009788905_1009788908 22 Left 1009788905 6:68374143-68374165 CCGAAAATAACCTTAAAAGATAC No data
Right 1009788908 6:68374188-68374210 GGAGAACTGCTCAATGCCCAAGG No data
1009788905_1009788907 1 Left 1009788905 6:68374143-68374165 CCGAAAATAACCTTAAAAGATAC No data
Right 1009788907 6:68374167-68374189 ATCAATTTGTTAGTGCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009788905 Original CRISPR GTATCTTTTAAGGTTATTTT CGG (reversed) Intergenic
No off target data available for this crispr