ID: 1009789770

View in Genome Browser
Species Human (GRCh38)
Location 6:68386421-68386443
Sequence CCAGGCTGCCAGGCAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009789763_1009789770 11 Left 1009789763 6:68386387-68386409 CCCCTTCAACTCTCCTATGTAAG No data
Right 1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG No data
1009789765_1009789770 9 Left 1009789765 6:68386389-68386411 CCTTCAACTCTCCTATGTAAGTC No data
Right 1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG No data
1009789766_1009789770 -2 Left 1009789766 6:68386400-68386422 CCTATGTAAGTCAGTTAGAAGCC No data
Right 1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG No data
1009789764_1009789770 10 Left 1009789764 6:68386388-68386410 CCCTTCAACTCTCCTATGTAAGT No data
Right 1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009789770 Original CRISPR CCAGGCTGCCAGGCAGAGAC TGG Intergenic
No off target data available for this crispr