ID: 1009790525

View in Genome Browser
Species Human (GRCh38)
Location 6:68395656-68395678
Sequence CTCCATTGCCTGGCAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009790523_1009790525 13 Left 1009790523 6:68395620-68395642 CCTAGAGAGTGGGAACTTTGTCT No data
Right 1009790525 6:68395656-68395678 CTCCATTGCCTGGCAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009790525 Original CRISPR CTCCATTGCCTGGCAAAAAT AGG Intergenic
No off target data available for this crispr