ID: 1009792591

View in Genome Browser
Species Human (GRCh38)
Location 6:68422160-68422182
Sequence GTCAATGATCCCAATGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009792582_1009792591 11 Left 1009792582 6:68422126-68422148 CCATTAAGTGCGGCCAGCCATCC No data
Right 1009792591 6:68422160-68422182 GTCAATGATCCCAATGGGATGGG No data
1009792580_1009792591 26 Left 1009792580 6:68422111-68422133 CCAACACAAATCACACCATTAAG No data
Right 1009792591 6:68422160-68422182 GTCAATGATCCCAATGGGATGGG No data
1009792584_1009792591 -2 Left 1009792584 6:68422139-68422161 CCAGCCATCCCAGGAAAGCAAGT No data
Right 1009792591 6:68422160-68422182 GTCAATGATCCCAATGGGATGGG No data
1009792586_1009792591 -10 Left 1009792586 6:68422147-68422169 CCCAGGAAAGCAAGTCAATGATC No data
Right 1009792591 6:68422160-68422182 GTCAATGATCCCAATGGGATGGG No data
1009792585_1009792591 -6 Left 1009792585 6:68422143-68422165 CCATCCCAGGAAAGCAAGTCAAT No data
Right 1009792591 6:68422160-68422182 GTCAATGATCCCAATGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009792591 Original CRISPR GTCAATGATCCCAATGGGAT GGG Intergenic
No off target data available for this crispr