ID: 1009793975

View in Genome Browser
Species Human (GRCh38)
Location 6:68442271-68442293
Sequence AAATTGCAAGTGATGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009793972_1009793975 13 Left 1009793972 6:68442235-68442257 CCTTGCTGAAGTTGTTCTGTGGA No data
Right 1009793975 6:68442271-68442293 AAATTGCAAGTGATGTAGCCAGG No data
1009793970_1009793975 14 Left 1009793970 6:68442234-68442256 CCCTTGCTGAAGTTGTTCTGTGG No data
Right 1009793975 6:68442271-68442293 AAATTGCAAGTGATGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009793975 Original CRISPR AAATTGCAAGTGATGTAGCC AGG Intergenic
No off target data available for this crispr