ID: 1009796641

View in Genome Browser
Species Human (GRCh38)
Location 6:68477786-68477808
Sequence TGCCAGGGATAGAACCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009796641_1009796648 28 Left 1009796641 6:68477786-68477808 CCATCCAGGTTCTATCCCTGGCA No data
Right 1009796648 6:68477837-68477859 CCAGCTACTTAATCCCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009796641 Original CRISPR TGCCAGGGATAGAACCTGGA TGG (reversed) Intergenic
No off target data available for this crispr