ID: 1009803767

View in Genome Browser
Species Human (GRCh38)
Location 6:68575637-68575659
Sequence CACAGTTAACAATATGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009803766_1009803767 18 Left 1009803766 6:68575596-68575618 CCATTATTTCTATAGTTTTTAAT No data
Right 1009803767 6:68575637-68575659 CACAGTTAACAATATGACCTAGG No data
1009803765_1009803767 19 Left 1009803765 6:68575595-68575617 CCCATTATTTCTATAGTTTTTAA No data
Right 1009803767 6:68575637-68575659 CACAGTTAACAATATGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009803767 Original CRISPR CACAGTTAACAATATGACCT AGG Intergenic
No off target data available for this crispr