ID: 1009806495

View in Genome Browser
Species Human (GRCh38)
Location 6:68606962-68606984
Sequence GACAGCTCCCGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009806493_1009806495 11 Left 1009806493 6:68606928-68606950 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1009806495 6:68606962-68606984 GACAGCTCCCGGCCTGTTACTGG No data
1009806491_1009806495 16 Left 1009806491 6:68606923-68606945 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1009806495 6:68606962-68606984 GACAGCTCCCGGCCTGTTACTGG No data
1009806492_1009806495 15 Left 1009806492 6:68606924-68606946 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1009806495 6:68606962-68606984 GACAGCTCCCGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009806495 Original CRISPR GACAGCTCCCGGCCTGTTAC TGG Intergenic
No off target data available for this crispr