ID: 1009808488

View in Genome Browser
Species Human (GRCh38)
Location 6:68633130-68633152
Sequence TTCAAGTAGAAGTCAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009808488_1009808492 -8 Left 1009808488 6:68633130-68633152 CCCTGCCCTGACTTCTACTTGAA No data
Right 1009808492 6:68633145-68633167 TACTTGAATATAAATGATCCTGG No data
1009808488_1009808493 -7 Left 1009808488 6:68633130-68633152 CCCTGCCCTGACTTCTACTTGAA No data
Right 1009808493 6:68633146-68633168 ACTTGAATATAAATGATCCTGGG No data
1009808488_1009808496 24 Left 1009808488 6:68633130-68633152 CCCTGCCCTGACTTCTACTTGAA No data
Right 1009808496 6:68633177-68633199 AACCTTTCCATTTAGGATTTAGG No data
1009808488_1009808495 17 Left 1009808488 6:68633130-68633152 CCCTGCCCTGACTTCTACTTGAA No data
Right 1009808495 6:68633170-68633192 GTAAGTGAACCTTTCCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009808488 Original CRISPR TTCAAGTAGAAGTCAGGGCA GGG (reversed) Intergenic
No off target data available for this crispr