ID: 1009811539

View in Genome Browser
Species Human (GRCh38)
Location 6:68673858-68673880
Sequence CTTCAAATGCAGAGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009811534_1009811539 -4 Left 1009811534 6:68673839-68673861 CCTGGGACAAATCTTTGTCCTTC 0: 1
1: 0
2: 2
3: 14
4: 212
Right 1009811539 6:68673858-68673880 CTTCAAATGCAGAGGGAATAGGG 0: 1
1: 0
2: 0
3: 19
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009811539 Original CRISPR CTTCAAATGCAGAGGGAATA GGG Intronic
900571072 1:3358493-3358515 CTTCGGATGCAGCTGGAATAAGG + Intronic
901495315 1:9617860-9617882 CTACAAAGGCAGAGGGAAGTGGG + Intergenic
901594628 1:10375134-10375156 GTTCAAAACCAGAGAGAATAGGG - Intronic
902614804 1:17618077-17618099 CCCAAAATGCAGAGGGAACATGG - Intronic
904279847 1:29411309-29411331 TTACAAATCAAGAGGGAATAGGG + Intergenic
906788895 1:48641511-48641533 CTTCAAAGGCAGAAGGACTTGGG + Intronic
909049399 1:70750474-70750496 AAGCAAATGCTGAGGGAATATGG - Intergenic
909932922 1:81518624-81518646 CTTCAAATCCACAGTGACTATGG + Intronic
911458857 1:98162977-98162999 CTCCAGGTGCAGAGGGAGTAAGG + Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912679830 1:111722037-111722059 TGTCAAATTCAGAGGGAATCTGG + Intronic
912860050 1:113206250-113206272 TTTCAAACCCAAAGGGAATATGG - Intergenic
916122138 1:161538008-161538030 CTTCTCATGCAAAGGGAATTGGG - Intergenic
916132026 1:161619433-161619455 CTTCTCATGCAAAGGGAATTGGG - Intronic
917146497 1:171897390-171897412 CTTCAAATAAAAATGGAATAGGG - Intronic
918092072 1:181305681-181305703 CTACAAAAGCACAGGGAAAAGGG + Intergenic
918182538 1:182096808-182096830 CTCCAAATGCAATGGGAAAAAGG - Intergenic
918672529 1:187237437-187237459 CATCCAATGCTGAGAGAATAAGG + Intergenic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
920219042 1:204382575-204382597 CTTCAAATGCAAGAGGAAAAGGG - Intergenic
921008496 1:211117102-211117124 CTTCAGAGGAAGAGGCAATATGG + Intronic
923239231 1:232064238-232064260 CTTCAAATGAGGAGGGTAAAAGG + Intergenic
923374041 1:233342106-233342128 CTTTATATTCATAGGGAATAAGG + Intronic
923881960 1:238113296-238113318 TTTAAAATGCAGAGGAAAGATGG + Intergenic
1063572498 10:7229248-7229270 AATCAGATGCAGAGGGACTATGG + Intronic
1064126031 10:12661068-12661090 GTTGAAAAGCAGAAGGAATAGGG - Intronic
1065765478 10:29025766-29025788 CTCCCAAAGCAGAGGGATTATGG + Intergenic
1068463157 10:57352966-57352988 CTTCAAATACAGGCTGAATATGG - Intergenic
1070522809 10:77269227-77269249 CTTAAAAAGCACAAGGAATAAGG + Intronic
1070943835 10:80371821-80371843 CTTCAAAAGCAGCGGTAATTTGG - Intergenic
1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG + Intronic
1071170126 10:82854511-82854533 CTTCAAATGCAGAAGGTATCTGG - Intronic
1074710373 10:116172488-116172510 CTCCAGATTCAGTGGGAATAGGG + Intronic
1074910037 10:117900080-117900102 CTTCAGAAGCACAGGGACTAAGG + Intergenic
1078755536 11:14205218-14205240 GCACAAATGCAGTGGGAATATGG - Intronic
1080526063 11:33120342-33120364 GTTCAAAGGTAGTGGGAATATGG + Intronic
1080883148 11:36341318-36341340 ATTCAGAGGCAAAGGGAATATGG + Intronic
1080981743 11:37415748-37415770 CTTCAGTAGAAGAGGGAATAGGG + Intergenic
1081476850 11:43441755-43441777 ATTCAAATGAAGAGAGAATATGG - Intronic
1081568019 11:44271596-44271618 CATGAAATGCAGAGGTAATGTGG - Intronic
1083421118 11:62553821-62553843 CCTCAAATGCTGAGGGATAAGGG - Intronic
1083465990 11:62846480-62846502 CTTAAAATCACGAGGGAATATGG - Intergenic
1086130842 11:83400744-83400766 CTTCAAAAGCTAAGGGAGTATGG + Intergenic
1088482941 11:110312957-110312979 CTTTAAATGGAGAGGAAAAATGG + Intergenic
1090043478 11:123310903-123310925 CTACAAATGGAGAGGCAACATGG - Intergenic
1090387194 11:126364118-126364140 CTGCCAAGGCAGAGGGAATGGGG + Intronic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1093899201 12:24610611-24610633 CTTCAAAAGCACAGGAAACAAGG - Intergenic
1094683805 12:32690373-32690395 ATTCAAATCCACTGGGAATATGG - Intronic
1095745515 12:45654035-45654057 TTGCAAATGCACAGGGAAAATGG + Intergenic
1098349901 12:69547665-69547687 CTACACATACACAGGGAATAAGG - Intronic
1098870103 12:75807883-75807905 CTTGAAATCAAGAGGGAATATGG + Intergenic
1099226464 12:79975696-79975718 CATCAAATACAGATGGAATGAGG + Intergenic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1100074285 12:90759877-90759899 CTTAAAATGCAAAAGGAATTGGG - Intergenic
1100297250 12:93274467-93274489 CTTCTAGTCCAGAGGGATTAAGG + Intergenic
1100424590 12:94472321-94472343 CTTCAAATGCGGAGGTACTGTGG - Intergenic
1100862100 12:98817216-98817238 CTTCAAAGGCAGAAGAAAAAAGG + Intronic
1101934857 12:109048949-109048971 CTTCTAAGGAAGAGGGTATAAGG + Intronic
1102385562 12:112506518-112506540 ATTCAAATGCAAAGAAAATATGG - Exonic
1104130832 12:125892335-125892357 TTTCAAATTCAGAGGAAACAAGG + Intergenic
1104272775 12:127297100-127297122 CTTAAAATACAGAGAAAATATGG - Intergenic
1104640268 12:130462669-130462691 CGTCAACTGCACAGGGACTAGGG - Intronic
1105359690 13:19696868-19696890 ATTCAAATGAAGAGGGTATGTGG - Intronic
1106895181 13:34292373-34292395 TGCCAAATGCAGGGGGAATATGG - Intergenic
1108058388 13:46507995-46508017 TTTCAAAGGCAGAGGGTTTAAGG - Intergenic
1109796459 13:67320107-67320129 CTGCAAATCAAGAGGGAAAATGG - Intergenic
1110799415 13:79677896-79677918 AGTCAAATGCAGTGGGATTAAGG + Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1115453572 14:33576177-33576199 CGCCAAATGCAAAGGGAATCTGG - Intronic
1115705588 14:35994749-35994771 CTTCAAAGGCAGTGGGCAGAAGG - Intergenic
1115741162 14:36390492-36390514 CTGCAAATGCTGATGTAATAGGG - Intergenic
1115876591 14:37868423-37868445 CTTCAAAAGGAGAGAGAACATGG - Intronic
1116073114 14:40074326-40074348 CTTCATATGCTGAGGGGACATGG - Intergenic
1120135825 14:80866683-80866705 CTTCAAATGCACAGAAACTAAGG + Intronic
1121144546 14:91572780-91572802 ATTCAAATGCAAAGGAAAGAGGG + Intergenic
1124425412 15:29558669-29558691 TTTCAACTGCAGAGGGAGTCAGG - Intronic
1126936689 15:53717586-53717608 CTTGGAATGTAGGGGGAATAAGG - Intronic
1127278675 15:57470035-57470057 GTTAAAATGCAGAGGAAATGAGG - Intronic
1127659117 15:61083461-61083483 CCTCAGATTCAGAGGGACTAAGG - Intronic
1132179798 15:99743700-99743722 CTTCCAAAGCAGTGGGATTATGG - Intergenic
1135824912 16:25718170-25718192 CTTCAAAGGAAGTGGGTATAGGG - Intronic
1137563477 16:49518107-49518129 CATAAATTGCAGAGAGAATAGGG - Intronic
1139877728 16:70159807-70159829 CTGCAAATCCAGCAGGAATAAGG + Exonic
1140303725 16:73783000-73783022 CTTCAGATGCTGGGGCAATATGG + Intergenic
1141287877 16:82689562-82689584 CTTCAAGTGTAGAAGAAATATGG - Intronic
1143961013 17:10719690-10719712 CTCCAAATCCAGAAGCAATAAGG + Intronic
1144400100 17:14887522-14887544 CTTCAATTCCAGAAGGAAAATGG - Intergenic
1144532964 17:16057955-16057977 CTTCACAGGCAGAGGGAATGGGG - Exonic
1144883886 17:18445549-18445571 CTTCAAATGCTGAGTGCAAATGG - Intergenic
1145015221 17:19392151-19392173 CTGCACCTGCAGAGAGAATAGGG - Intergenic
1146422747 17:32704199-32704221 ACTCAAATGTAGAGGGTATATGG + Intronic
1146706503 17:35004250-35004272 CTGCAAATGCAGAGGGGTCAGGG - Intronic
1146807031 17:35872816-35872838 CTTAAGATGCAGAGAGAATAAGG + Intronic
1147412778 17:40265568-40265590 CAACAAATGCAGAGGCCATAAGG + Intronic
1148966828 17:51442793-51442815 CTAGAAATGCAGAGGGAAACGGG - Intergenic
1149196120 17:54123349-54123371 ATAAAAAAGCAGAGGGAATAGGG - Intergenic
1149358194 17:55866075-55866097 CTTCAAATGCAGATGGCACCAGG + Intergenic
1149503385 17:57172372-57172394 ATTTAACTGCAGAGGGAAGAGGG + Intergenic
1149763117 17:59251178-59251200 GTTCCAATGGAGAGGGAGTATGG - Intronic
1154050586 18:10952836-10952858 TTCCAAATGCTGAGGAAATATGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1160566018 18:79787187-79787209 CCTCAAATGCAGCGGGGAGACGG + Intergenic
1163129996 19:15266378-15266400 CTTGAGATGCACAGGGAACATGG - Intronic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1167782463 19:51608060-51608082 TCTCAAATGCAGAGGTAAGAAGG - Intergenic
926024066 2:9524504-9524526 TTTCGACTGCAGAGGGAAGAAGG + Intronic
926163336 2:10503007-10503029 CCTCAACTGCAGAGAGAATTGGG + Intergenic
926207801 2:10846468-10846490 CTTCAAATTCAGAGGAAAGGGGG - Intergenic
926406545 2:12558744-12558766 CTTCAAAGGAAGTGAGAATAAGG + Intergenic
926915252 2:17885206-17885228 CTTCCAATGTAGATGGGATAAGG + Intronic
926980625 2:18563384-18563406 CTTCAAAGGTAGAAGGAGTATGG - Exonic
928825958 2:35421245-35421267 CTTTATAAGCAGAGGAAATATGG - Intergenic
929080939 2:38121444-38121466 CTTCAAATACAGAGTGAACTTGG + Intergenic
930889995 2:56373709-56373731 CTTCTAAGTCAGAGGAAATATGG + Intronic
932037288 2:68258944-68258966 ATTTAAATGCAGAGGGCATGTGG + Intronic
933403424 2:81827707-81827729 CTTCAAGAGCAGAGGAAATTAGG + Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
934705553 2:96475720-96475742 CTTCAAAAGCAGAAGTTATAAGG - Intergenic
935323235 2:101908594-101908616 CTTAAAATCCAGATGAAATAAGG - Intergenic
935605089 2:104963981-104964003 CCACAAATGCAGAGGGATGATGG - Intergenic
939204534 2:139083388-139083410 CTTAAAGTGCAAAGGGAAAATGG + Intergenic
941485092 2:166070458-166070480 CTTCAAATGCACATGGTATGAGG - Intronic
941709716 2:168699147-168699169 CTCCAAATGGAGGCGGAATAAGG - Intronic
941743828 2:169065220-169065242 CACAAAATGGAGAGGGAATACGG - Intronic
941963649 2:171278398-171278420 CTTCAAATGCAGATTGAAGGGGG + Intergenic
942582993 2:177441440-177441462 CATCAGCTGAAGAGGGAATATGG - Intronic
943197419 2:184771969-184771991 TCTCAAAGGGAGAGGGAATAGGG + Intronic
943726368 2:191255777-191255799 CTCAAAATGCAGAGGGGGTAGGG - Intronic
945128075 2:206535561-206535583 CTTCAATTGTTGAAGGAATAAGG + Intronic
946201389 2:218072762-218072784 CTTCAACTGCAGAGTGCACAGGG - Exonic
946623605 2:221587149-221587171 CTTCATATGCACAGAGAAAAGGG + Intergenic
947884664 2:233557818-233557840 GTTCAGAAGCAGAGGCAATAAGG + Intronic
1168901576 20:1369477-1369499 TTTCAAAGGCAGAGGGTTTAAGG + Exonic
1168945616 20:1754139-1754161 CTTCAAAAGCACAGGCAACAAGG + Intergenic
1170062155 20:12270522-12270544 CTTCAATTGCAAAAGCAATAGGG - Intergenic
1170209367 20:13833177-13833199 CTGCAAATGCAGAATGAAAATGG - Intergenic
1170255343 20:14336745-14336767 GTTCTATTGAAGAGGGAATATGG + Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170871565 20:20211142-20211164 CATCAAATCCAGAGGGAAAATGG + Intronic
1171727454 20:28638230-28638252 CTTAAAATGGAGATGGAATGTGG + Intergenic
1171750783 20:29046389-29046411 CTTAAAATGGAGATGGAATGTGG - Intergenic
1172611511 20:36256047-36256069 CTTCTCATTCAGAGGAAATATGG - Exonic
1172943923 20:38673833-38673855 TTTCCAAGGCAGAGGGAATCAGG + Intergenic
1173088650 20:39949588-39949610 CTTCAAATAGAGAAGTAATATGG - Intergenic
1175530321 20:59670543-59670565 GGTCAAATGCAGAGAGAACATGG - Intronic
1176874023 21:14108197-14108219 CTTCATCTGCAGAGATAATATGG + Intergenic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1177009459 21:15714736-15714758 CTTCAAAAGTAGAAGGAATTAGG + Intergenic
1177921456 21:27157632-27157654 CTTCAAATGCCGAATGACTATGG + Intergenic
1180698712 22:17770194-17770216 CTTAAAATGCAGATGGACTTGGG - Intronic
1180792015 22:18580207-18580229 TTTCAAATGCAGATGAAACAAGG - Intergenic
1181229719 22:21415102-21415124 TTTCAAATGCAGATGAAACAAGG + Intergenic
1181248930 22:21519764-21519786 TTTCAAATGCAGATGAAACAAGG - Intergenic
1182645928 22:31809359-31809381 ATTCAATTGCAGAGAGAATAAGG - Intronic
1182906505 22:33942072-33942094 CTTCTAATGCACAGGGTTTAGGG - Intergenic
1182988611 22:34744556-34744578 CTGCAAATGCAGAGGGCTTGTGG + Intergenic
1184357618 22:43993035-43993057 TCCCAACTGCAGAGGGAATAAGG - Intronic
949695791 3:6693681-6693703 CTGCAAATGAAGAGTGAATAAGG - Intergenic
950739521 3:15039076-15039098 TTTCAAATACAGAGGGAACTGGG + Intronic
952138509 3:30451974-30451996 CTTCAATTGCAGTGGGGATTAGG - Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
955028925 3:55197865-55197887 CTTTAGATGCAGACGGAATTGGG - Intergenic
956288204 3:67632720-67632742 CTCCAATTGCAGATGGAAAACGG + Intronic
957181076 3:76878048-76878070 CTCCAAATGCAGTGGCATTAGGG + Intronic
957320249 3:78620742-78620764 ATTGAAATTCAGAGGGATTAAGG + Intronic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
960356812 3:116663814-116663836 ATAGAAATGCAGAGGGAAGAAGG + Intronic
962549581 3:136476068-136476090 CTACAAATTCAGAGGAAATGGGG - Intronic
964809977 3:160652947-160652969 ATTCAAAAGCAGAGTGAAAATGG + Intergenic
964989665 3:162793142-162793164 GTTTAAATTCAGAAGGAATATGG + Intergenic
966976268 3:185086103-185086125 CCTCAGATCCAGAGGGAACAAGG + Intronic
967505993 3:190253299-190253321 CTTCCAATTCACAGGAAATATGG + Intergenic
967941959 3:194773030-194773052 CCTCAAATGCAAATAGAATAAGG + Intergenic
968290781 3:197538054-197538076 CTTAAAAGGCAGAGAGAAGAAGG - Intronic
971154741 4:24069259-24069281 CTTCAAATTCAAAGTGGATATGG + Intergenic
973796762 4:54435026-54435048 CTTGAAAAGGAGAGGGAGTAGGG - Intergenic
974764799 4:66329912-66329934 CTTTAAACGTATAGGGAATAAGG - Intergenic
978964088 4:114721324-114721346 AGTGAAATCCAGAGGGAATATGG - Intergenic
979931858 4:126641671-126641693 CTTCAAATTCAGAGGGGTTTTGG - Intergenic
979943883 4:126800258-126800280 CTTCAGCTGCAGAGGGCATCAGG + Intergenic
980867860 4:138574627-138574649 CTTCATGAGAAGAGGGAATAGGG - Intergenic
981330249 4:143499913-143499935 GTTCCAATGCAGAGTGAAGAGGG - Intergenic
981539241 4:145831765-145831787 CTTAAAATGCAGGAGGAAAAAGG + Intronic
982619322 4:157683666-157683688 CTTCAAAGGAAGAGAGAATGTGG + Intergenic
982664999 4:158250974-158250996 CTTCAAATCTGTAGGGAATAGGG - Intronic
983400544 4:167259160-167259182 CTTCACTTGCAGACTGAATATGG + Intergenic
984815147 4:183829513-183829535 CACCAAATGCAAAGGGAATGAGG - Intergenic
987213574 5:15709576-15709598 CTTCAAATACAGACAGAATCAGG + Intronic
990988796 5:61664999-61665021 CTTAGATTGTAGAGGGAATACGG - Intronic
994328376 5:98476379-98476401 TTTAAAATGCACAGGAAATAGGG + Intergenic
996503321 5:124240819-124240841 CTTCATATGGAGAGGAAAGATGG + Intergenic
997438558 5:133892503-133892525 GTTCAAGTGCAGCTGGAATATGG + Intergenic
999451875 5:151684785-151684807 CTTTAACTGTAGAGGGAATGGGG + Intronic
1000137269 5:158364929-158364951 GTTCAAATGAAGAGGGGAAAAGG + Intergenic
1000366873 5:160500041-160500063 CTACAAATGGAGAGGGGATATGG + Intergenic
1003519670 6:6847674-6847696 CTTCTAATGCAGAGGGCTCAGGG - Intergenic
1003741246 6:8942979-8943001 CTTGACATGTAGAGAGAATAAGG + Intergenic
1005286277 6:24330481-24330503 CTTCAAAAGGAGAAGGAATTTGG + Intronic
1006863459 6:37189415-37189437 CTTCAAAGACAGAGGGAAACAGG + Intergenic
1007517400 6:42423597-42423619 CTACAAATGCAGATAGGATATGG - Intronic
1008470749 6:51881604-51881626 CTTCAATTGCACATGGAAAATGG - Intronic
1009023752 6:57973155-57973177 CCCCAAATGCACAGGGCATATGG + Intergenic
1009199329 6:60724706-60724728 CCCCAAATGCACAGGGCATATGG + Intergenic
1009397118 6:63212487-63212509 TTTCAAAGGCAGAGGGTTTAAGG - Exonic
1009721194 6:67471902-67471924 CTTCAAATTCACAGAGAATTTGG + Intergenic
1009811539 6:68673858-68673880 CTTCAAATGCAGAGGGAATAGGG + Intronic
1011787360 6:90862123-90862145 CTTCATATGCAGAGTGAAAAAGG - Intergenic
1014038302 6:116793839-116793861 TTTCAAAAGCAGAGGCAATATGG + Intronic
1014700671 6:124683743-124683765 CTTCAAATGCAGAGACAAAAGGG + Intronic
1015137515 6:129890562-129890584 CTCCAAATGCAGAGTGAGCAGGG + Intergenic
1017056021 6:150436269-150436291 GGTCAAATGAAGAGGGAAAAAGG + Intergenic
1021310555 7:19090667-19090689 CTGCAAGTGCAGCTGGAATAAGG - Intronic
1021541668 7:21766242-21766264 ATTCAGATTCAGAGGGAAAAAGG + Intronic
1021667408 7:22998691-22998713 CAGCAGATGCAGAGGAAATAAGG - Intronic
1023664209 7:42504248-42504270 CATAAAATGGAGAGGGTATAGGG - Intergenic
1024355501 7:48410204-48410226 CTTCAAAGACAGAGAGAACAGGG + Intronic
1024775052 7:52774284-52774306 CTTAAAAAACAGAGGGAAAAAGG + Intergenic
1026459185 7:70598527-70598549 CGGCAAATGCATAGGGAAAAAGG - Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1027925749 7:84461069-84461091 CTTAAAATTCATAGGGTATAAGG + Intronic
1028719518 7:94012627-94012649 CTTCAAATGCAGTCTCAATAGGG - Intergenic
1030679106 7:112415626-112415648 CCTCTACTGCAGAGGGACTAGGG - Intergenic
1031165019 7:118217374-118217396 ATTTAAATGCAAAGTGAATATGG - Intronic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031266947 7:119593017-119593039 CTTCAAATGCGGGGAGATTATGG - Intergenic
1033815402 7:145065634-145065656 CTTCCACTGCACAGGGCATAAGG + Intergenic
1034716594 7:153248616-153248638 CATCAAACGCAGAGGGAAATGGG - Intergenic
1035851047 8:2919621-2919643 ATGCAAATGCTGAGGGAATTAGG - Intergenic
1036415524 8:8544312-8544334 CTCCAAAGGCAAAGGGAATTTGG - Intergenic
1037061408 8:14514263-14514285 CTTCAAATGGAGAGGTAAATTGG + Intronic
1037981846 8:23259891-23259913 CTTCAAGGGCAGTGGGAATCAGG + Intronic
1038285206 8:26200294-26200316 CTTCATAAGCAGAGGGAATTTGG + Intergenic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1042935650 8:74055335-74055357 CTTCAAATGCAGAGGGACAGAGG - Intergenic
1046675725 8:117105871-117105893 CTGGAAATGCAGAAGAAATAGGG - Intronic
1046759880 8:118009936-118009958 CTTCAACTGCTGAGGGAATTGGG + Intronic
1047433752 8:124817027-124817049 CCTTAAATGATGAGGGAATATGG + Intergenic
1047975856 8:130129849-130129871 ATTCATATGCAGAAGGAATGGGG + Intronic
1047991093 8:130287629-130287651 ATTCAAATGCAGAGGGTTTGAGG - Intronic
1049755043 8:144307413-144307435 CTGCAGATGGAGTGGGAATAGGG + Intronic
1051530161 9:18093443-18093465 GTTCAAATTCAGATGGCATAAGG + Intergenic
1051538884 9:18191823-18191845 CATGAAATGGAGAGAGAATATGG - Intergenic
1052776245 9:32736187-32736209 ATTCAAATACAGAGGGAAAGAGG - Intergenic
1053722285 9:40958873-40958895 CTTAAAATGGAGATGGAATGTGG - Intergenic
1054343683 9:63893125-63893147 CTTAAAATGGAGATGGAATGTGG + Intergenic
1059214127 9:112544398-112544420 CTTTAAATTCAGTGGGAATAGGG + Intronic
1059762553 9:117352516-117352538 CTTCCAATGCACAGGGATTGAGG + Intronic
1059858236 9:118425913-118425935 CTTCATACACAGAGGAAATACGG - Intergenic
1060212323 9:121718113-121718135 CTTCACAGGCAGAGGGACTGAGG - Intronic
1061420710 9:130471691-130471713 CTTCAAATGCAGCGAGGAGACGG - Intronic
1062203547 9:135321871-135321893 CTTCCAAGTCAGAGGGAAGATGG - Intergenic
1203452890 Un_GL000219v1:137107-137129 CTTAAAATGGAGATGGAATGTGG + Intergenic
1187923608 X:24230052-24230074 CTCAAAATGCACAGGGAATTTGG - Intergenic
1189227850 X:39428270-39428292 CTTGAAATGCAGAGGAATGAGGG - Intergenic
1189801129 X:44692739-44692761 CTTCAGATCTAGAGGTAATAAGG + Intergenic
1190411399 X:50140434-50140456 CTTCAAGTCCAGAGGGAACAAGG - Intergenic
1194415322 X:93604940-93604962 GTTCAAAGGCAAAAGGAATAAGG + Intergenic
1195536733 X:106015898-106015920 CTGCAAATACAGAAGCAATAGGG + Intergenic
1197257787 X:124282688-124282710 GTTCAAATCTAGAGGGAAAAAGG + Intronic
1197559375 X:127999188-127999210 CTTCATCTGCAGCTGGAATAGGG - Intergenic
1200268106 X:154657194-154657216 CTGCAAAAGAAGAGGAAATATGG - Intergenic
1200949137 Y:8876568-8876590 CTTCAAAAGCAGTTGAAATAAGG + Intergenic