ID: 1009815248

View in Genome Browser
Species Human (GRCh38)
Location 6:68725029-68725051
Sequence GCACCACCAACCACATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009815244_1009815248 9 Left 1009815244 6:68724997-68725019 CCTGTGGGAATGCTACTGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1009815248 6:68725029-68725051 GCACCACCAACCACATTTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009815248 Original CRISPR GCACCACCAACCACATTTGG GGG Intronic
902600237 1:17535951-17535973 GCCCAACCTACCACATGTGGTGG - Intergenic
910112810 1:83700749-83700771 GCTCCACCAGCCACAGTTAGGGG + Intergenic
912925106 1:113906381-113906403 GAACCACCCAGCACATTAGGTGG - Intronic
913132976 1:115859524-115859546 GCACCACGCACAACATCTGGGGG - Intergenic
914447923 1:147765778-147765800 ACATCCCCAACCCCATTTGGAGG - Intronic
1063058819 10:2529620-2529642 GCCCCACCAGCCACATTTCACGG + Intergenic
1064827735 10:19424700-19424722 TTACCACCAAACACAATTGGAGG - Intronic
1068589787 10:58841790-58841812 GCATCACCAACCACTTTATGTGG - Intergenic
1069077516 10:64053341-64053363 CCACCACCAACCACATCAGCTGG - Intergenic
1071433596 10:85626019-85626041 GCACCAGCATTCTCATTTGGGGG - Intronic
1072349527 10:94543802-94543824 GCGCCACCAAACACATGTGCTGG - Intronic
1072836511 10:98720274-98720296 GCATTACTAACCAAATTTGGGGG + Intronic
1073202410 10:101746394-101746416 CCACAACCACCCTCATTTGGGGG + Intergenic
1076751516 10:132545764-132545786 GCAGCACCAACCAGACCTGGTGG - Intronic
1079427045 11:20353377-20353399 ACAGCACCAACCTCATTGGGTGG - Intergenic
1081345976 11:41986705-41986727 GCACAATCAATCACATTTTGTGG + Intergenic
1082909451 11:58353905-58353927 GCACTACCATCCTCACTTGGGGG + Intergenic
1083385019 11:62301531-62301553 GCACCACAGACCCCATTTTGGGG + Intergenic
1084788908 11:71460845-71460867 GCACCACCAACCACAGAGGGCGG - Intronic
1085672230 11:78477944-78477966 ACACGACCAACCACGTTTGAGGG - Intronic
1087269455 11:96096836-96096858 TCACCACCAAGCACAGCTGGAGG + Intronic
1091485923 12:888295-888317 CCATCAGCCACCACATTTGGGGG + Intronic
1098523568 12:71461039-71461061 GCCACAGCATCCACATTTGGAGG + Intronic
1100903012 12:99264895-99264917 CCACCACCAGCCACAATTGCAGG - Intronic
1104571752 12:129932151-129932173 GCAACAGCCACCACATTTTGTGG - Intergenic
1108089776 13:46837051-46837073 GCTCCATCACCCAGATTTGGGGG + Intronic
1108112839 13:47095253-47095275 ACACAACCAACCACATGTGTAGG - Intergenic
1109204081 13:59462373-59462395 GCACCCGCAACCACACCTGGCGG + Intergenic
1112902376 13:104373989-104374011 GCAGCAGCACCCACACTTGGAGG - Intergenic
1116626860 14:47276468-47276490 ACACCTCCATCAACATTTGGTGG - Intronic
1116956068 14:50924919-50924941 CCACCACCAAACACATTGGAGGG + Intronic
1117105258 14:52391740-52391762 TGACCACCCACCACATTTGCAGG + Intergenic
1122084295 14:99289169-99289191 GCACTGCCAACCACACTCGGGGG - Intergenic
1125458675 15:39887412-39887434 GGCCCACCACCCACATTTGCTGG + Intronic
1126667517 15:51088830-51088852 GCACTACCAGCCACTTGTGGAGG - Intronic
1127920222 15:63488557-63488579 GCAGCACCAGCCCCACTTGGAGG + Intergenic
1127977767 15:64010940-64010962 GCACCAGCAACCCCATGTGGAGG + Intronic
1133290337 16:4716461-4716483 CCCCCACCAACTACATATGGGGG - Intronic
1133813748 16:9180719-9180741 GCACCCTCGAGCACATTTGGAGG - Intergenic
1138148676 16:54635561-54635583 ACCCCACCTACCACATTTAGAGG + Intergenic
1139682999 16:68580293-68580315 GCACCAGCGAGCACCTTTGGGGG - Intergenic
1145770036 17:27486396-27486418 GCAGTCACAACCACATTTGGCGG - Intronic
1152278439 17:79371625-79371647 GTCCCACCAACCAAATGTGGTGG + Intronic
1154257639 18:12797870-12797892 GCAGGTCCCACCACATTTGGCGG + Intronic
1160972010 19:1773636-1773658 GCACCACCGGCCACTTCTGGGGG + Intronic
1161066149 19:2238809-2238831 GCACAACCAGTCCCATTTGGAGG - Intronic
1165474379 19:36021702-36021724 GCATGAGCCACCACATTTGGCGG + Intronic
1167513473 19:49909338-49909360 GCTCCAGCTACCACATCTGGAGG - Exonic
1168411464 19:56142838-56142860 GCACCAGCACCCACATATGCTGG - Intronic
925193628 2:1905632-1905654 GCGCCAGCAACCACACCTGGAGG + Intronic
932500827 2:72181302-72181324 GTACGACCACCCACATGTGGAGG + Intronic
946430508 2:219624662-219624684 GCCACACCACCCAGATTTGGAGG - Intergenic
1168799499 20:635169-635191 TCACTACCAACCCCATGTGGTGG + Intergenic
1168864138 20:1070281-1070303 TCACCAGAAACCACATTTTGTGG + Intergenic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1176230965 20:64032723-64032745 GCAGCACCAACCCCAACTGGCGG - Intronic
1178207005 21:30479990-30480012 ACAGGACCAAACACATTTGGAGG + Exonic
1179114407 21:38476770-38476792 GCACCAACAACAACGTTTAGGGG + Intronic
1179654991 21:42839338-42839360 GACCCACCCACCACGTTTGGGGG - Intergenic
1179769470 21:43603667-43603689 GCAGCACCAACCACCTTGAGGGG + Intronic
1181051124 22:20238759-20238781 GCACCACCCAGCACAATTGGTGG - Intergenic
1183457784 22:37932132-37932154 GCACCACCCACTGCTTTTGGTGG - Intronic
952922755 3:38297419-38297441 CCACCACCAAACAGATTTAGGGG - Intronic
953004930 3:38969374-38969396 GCACCACCAAGCACATAAGAGGG + Intergenic
953153619 3:40347844-40347866 GCACCACAGACCCCATTTTGGGG + Intergenic
953424974 3:42788051-42788073 GCACCAATAACTAGATTTGGAGG + Intronic
959826561 3:110803938-110803960 GTACCACAAACCAAATGTGGTGG - Intergenic
960653736 3:119979790-119979812 GCACCACAAATCCCATTTTGGGG + Intronic
960993287 3:123325384-123325406 GCACAACCCACCACACTGGGGGG - Exonic
964423536 3:156529806-156529828 GCATTCCCAATCACATTTGGGGG - Intronic
965777943 3:172253439-172253461 GAGCCAACAACCACATTTTGAGG - Intronic
974844801 4:67339306-67339328 GCACCACAATCCTCATTTTGGGG - Intergenic
981102036 4:140839855-140839877 GCACCACCTTCTAAATTTGGGGG + Intergenic
984952984 4:185020173-185020195 GCACCTCCCACCACATTTTCTGG - Intronic
986344999 5:6826772-6826794 GCACCCCCATCCATCTTTGGAGG + Intergenic
986494650 5:8330412-8330434 GGCCCACCAAGCCCATTTGGGGG + Intergenic
992069637 5:73136842-73136864 GCACCACCAGCCGCATCTGGAGG - Intergenic
998549540 5:143064015-143064037 CCACCACCAAACACATGTGTGGG - Intronic
1008452936 6:51673921-51673943 GCACCAGGAACAACTTTTGGAGG + Intronic
1009815248 6:68725029-68725051 GCACCACCAACCACATTTGGGGG + Intronic
1015245642 6:131071527-131071549 TCACCTCCACCCACTTTTGGAGG - Intergenic
1015425409 6:133059985-133060007 CCACCAACAACCACAAGTGGAGG + Intergenic
1017100330 6:150844104-150844126 GCACCACCATCCATTTTTAGTGG - Intergenic
1019579764 7:1755604-1755626 GCAACACCAATCACAATGGGTGG - Intergenic
1022677800 7:32516045-32516067 GCACCACTCACCCCATTTGGGGG + Intronic
1024451210 7:49545528-49545550 GCTCCAAGAACCACATGTGGTGG - Intergenic
1029363676 7:100103934-100103956 CCACCTCCACCCACATCTGGGGG - Intronic
1029368520 7:100132350-100132372 CCACCACCAAACACATCTGCAGG + Intergenic
1030684516 7:112470923-112470945 GCAGAACCAACCAGATATGGAGG + Intronic
1034722621 7:153308600-153308622 GCACCTCCAATGACAATTGGTGG - Intergenic
1034839664 7:154384106-154384128 GCACCATCATCCTCATTTGATGG + Intronic
1035695060 8:1589869-1589891 GCAACACCATTTACATTTGGGGG + Intronic
1037413841 8:18626792-18626814 CCCCCACCAACCTCATTTGTTGG - Intronic
1038608932 8:29041395-29041417 GCACCACCAACCCAGTGTGGGGG - Intronic
1038997844 8:32945555-32945577 GCATCTCCAACCCCATCTGGGGG - Intergenic
1041672075 8:60501719-60501741 GCACCTCAAAACACATTTGTTGG + Intergenic
1042203018 8:66300044-66300066 GCAACAGCACCCACATTTTGAGG - Intergenic
1044559129 8:93595576-93595598 GCAGCACCTCCGACATTTGGTGG - Intergenic
1044637736 8:94343214-94343236 GCACCATCAACCACAATTTTAGG - Intergenic
1047047836 8:121074627-121074649 GCAACACCAACAACTTTTGAGGG + Intergenic
1049176771 8:141197553-141197575 ACACCACAAACCAGATGTGGCGG - Intergenic
1051810887 9:21048419-21048441 GCACTACCAAGCCCATTTAGGGG - Intergenic
1057188203 9:93070750-93070772 CCTCCACCACACACATTTGGGGG - Intronic
1059455278 9:114396714-114396736 GCATTACCAACCTCATTTTGTGG + Intergenic
1192555164 X:72083252-72083274 GCAATAACAACCACATTTGTAGG + Intergenic
1197509348 X:127351597-127351619 GCACCACAAACCTCATTTTGGGG + Intergenic
1198545186 X:137684886-137684908 GAACCACCTTCCACACTTGGGGG - Intergenic
1199965812 X:152819821-152819843 CCACCACCAACGACATCCGGAGG + Intergenic