ID: 1009815362

View in Genome Browser
Species Human (GRCh38)
Location 6:68726335-68726357
Sequence CTGTGTGCACATCTTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009815362_1009815363 -1 Left 1009815362 6:68726335-68726357 CCTTTCTCAAGATGTGCACACAG 0: 1
1: 0
2: 2
3: 16
4: 231
Right 1009815363 6:68726357-68726379 GTCAGTTGCAAAACCAAATTTGG No data
1009815362_1009815364 0 Left 1009815362 6:68726335-68726357 CCTTTCTCAAGATGTGCACACAG 0: 1
1: 0
2: 2
3: 16
4: 231
Right 1009815364 6:68726358-68726380 TCAGTTGCAAAACCAAATTTGGG 0: 1
1: 0
2: 0
3: 13
4: 235
1009815362_1009815366 20 Left 1009815362 6:68726335-68726357 CCTTTCTCAAGATGTGCACACAG 0: 1
1: 0
2: 2
3: 16
4: 231
Right 1009815366 6:68726378-68726400 GGGATTGATCTCCTGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009815362 Original CRISPR CTGTGTGCACATCTTGAGAA AGG (reversed) Intronic
900615471 1:3563765-3563787 CAGTGTTCACATCTGTAGAATGG - Intronic
905268289 1:36770079-36770101 ATGTGTGGACATCTGGAGAAGGG - Intergenic
906330218 1:44878000-44878022 CTGTGTCCACATCATGAAAGAGG - Intronic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
906883374 1:49617654-49617676 CTGAGTGCACATCATGTGATAGG - Intronic
907694392 1:56707265-56707287 CTGTGTGCAAGTCTTGTGATTGG + Intronic
909994007 1:82256973-82256995 TTTTGTGCACATATTGAGAGAGG + Intergenic
910660740 1:89669628-89669650 CTGTTTTCTCATCTTGAGAATGG - Intronic
915321777 1:155060486-155060508 CTGTGGGCACATATAGGGAAGGG - Intronic
916865371 1:168850706-168850728 CAGTGTGCAAATCTAGGGAATGG + Intergenic
917708636 1:177660489-177660511 CAGGGTGCACAGCTTGGGAATGG + Intergenic
918549646 1:185727443-185727465 TTGAGAGGACATCTTGAGAAGGG + Intergenic
920374395 1:205499735-205499757 CTGTTTGCTCACCTAGAGAATGG - Intergenic
921567733 1:216740401-216740423 GTGTGTGCACCTCTTGTGTAAGG - Intronic
921645363 1:217609274-217609296 CTGCTTGTACATCTTTAGAATGG - Intronic
922345050 1:224689563-224689585 CTGTGAGCACATGTTGGGGATGG + Intronic
922601608 1:226859479-226859501 GTGTGTGCACATCTTTGCAATGG + Intergenic
923106895 1:230861290-230861312 CTGTGTGTACATTTTGGGAAAGG + Intronic
923621432 1:235582554-235582576 CTGTCTGCACTTCTGGAGCACGG + Intronic
1062886588 10:1021138-1021160 GTGTGTGCACATCTGCAGGAAGG - Intronic
1063258725 10:4358838-4358860 CAGTGTGGACATATTGATAAGGG + Intergenic
1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG + Intergenic
1066428935 10:35334831-35334853 ATGTGTGGACATCGTGTGAACGG - Intronic
1067906726 10:50298754-50298776 CTGGGTGCTTATCTTTAGAATGG - Intergenic
1067919162 10:50435543-50435565 CTGTGTGCCCATGTTAATAAAGG - Intronic
1068941081 10:62681875-62681897 CTGAGTGCACATCATGACACAGG + Intergenic
1069797491 10:71062690-71062712 CTGTGTTCCCATCTGAAGAATGG - Intergenic
1070790150 10:79184289-79184311 GTGTGTGCACATCGGGAGAGGGG - Intronic
1070827533 10:79399825-79399847 CTCTGGGCACTTCTTCAGAATGG + Intronic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1074726668 10:116317235-116317257 CTGTGTTAACATCTTGAAAAAGG + Intergenic
1075534279 10:123256986-123257008 CAGTGTTCACATCTAGAAAATGG - Intergenic
1075771563 10:124942017-124942039 CTGTGTTCATAATTTGAGAATGG + Intergenic
1077417848 11:2433152-2433174 CTCTGTTCACATCTTGTGATGGG - Intergenic
1079566165 11:21885988-21886010 CTGTGTGGACATCAAGGGAAGGG + Intergenic
1083023693 11:59532144-59532166 CTGTGTGACCATCGTGAGTAGGG + Intergenic
1085929905 11:81069443-81069465 CTATGTGGATATCTGGAGAAAGG + Intergenic
1088047185 11:105468435-105468457 CTGCGTGCACACCTTCAGAGAGG + Intergenic
1088325777 11:108599449-108599471 CAGTGTGCATATTTTGATAAAGG + Intergenic
1089405575 11:118194709-118194731 CTGTGTGTACAGCCTCAGAAAGG + Intronic
1089983448 11:122791334-122791356 CTGTTTGCTCATCTAGAAAATGG + Intronic
1090188478 11:124753042-124753064 CTGGGTACACAGCTTGGGAAGGG + Intronic
1090555104 11:127865844-127865866 CAATGTTCACATCTTTAGAAAGG + Intergenic
1090655432 11:128840087-128840109 CTTTGTGGACATCTGGACAACGG - Exonic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092309955 12:7342053-7342075 CTGTGTGACCATCTTGAGTGGGG - Intergenic
1098146440 12:67502499-67502521 CTGTATGCATCTCTTGGGAAAGG - Intergenic
1102543118 12:113636532-113636554 CTGTTTGCACATCTATAAAATGG - Intergenic
1103268111 12:119648061-119648083 CTATGTGAAAATCTGGAGAATGG - Intergenic
1103616253 12:122154637-122154659 CTGTGTGCACAGCATGGGATGGG - Intergenic
1103883420 12:124183822-124183844 CTGTTTCCTCATCTTGAAAATGG - Intronic
1105561454 13:21496296-21496318 CTGTGTGCACACAGAGAGAAAGG - Intronic
1106870901 13:34019589-34019611 CTGTCTGTAAATATTGAGAAAGG - Intergenic
1107597756 13:41980703-41980725 CTGTGGCCAAATCTTGAGGATGG - Intergenic
1107927617 13:45278633-45278655 CTGTGTAGAGATCTAGAGAAAGG - Intronic
1111785813 13:92785305-92785327 CTATGTGCAAATGATGAGAAAGG - Intronic
1111918986 13:94390860-94390882 CTGTGTGAACCTCTTGCAAATGG + Intronic
1113087582 13:106584226-106584248 CTGTGGGCACATCTTTACAGTGG - Intergenic
1113499190 13:110759963-110759985 CAGTCTGCACATTTTCAGAATGG - Intergenic
1114931480 14:27474249-27474271 CTATATGTACAGCTTGAGAAGGG - Intergenic
1114982018 14:28177017-28177039 CTGTGAGCTCATCTTCAGAGGGG - Intergenic
1115182108 14:30641043-30641065 CTGTTTTCTCATCTTGAAAATGG - Intronic
1115570909 14:34665402-34665424 CTTTGTGCACATTTAGAAAAAGG + Intergenic
1115619193 14:35124010-35124032 CTGTGTTTACATCTTGATGAAGG - Exonic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1116022681 14:39480960-39480982 CTGTGTGCACTTCTTGAGACTGG + Intergenic
1118812309 14:69284322-69284344 CTGTGTGCAGCTCCTGAGACAGG - Intronic
1118814449 14:69300046-69300068 GTGTGTGCACATTTTAGGAAGGG + Intronic
1119415125 14:74464812-74464834 CAGTGAAAACATCTTGAGAAAGG + Intergenic
1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG + Intronic
1120312128 14:82842444-82842466 TTGTGTGCATATCTTGAGGAAGG + Intergenic
1120604552 14:86558424-86558446 CTGTGTTCACATTTTGTGTATGG + Intergenic
1121595505 14:95158651-95158673 CTGTGTGCACATTGTGAGGTAGG + Intergenic
1121662764 14:95647706-95647728 CAGTGTGGAAATTTTGAGAATGG - Intergenic
1122605386 14:102944606-102944628 CTGTGTGCACAGCCTGAGCCCGG + Intronic
1125051997 15:35310328-35310350 CTTTTTGCACATCTTAAAAAGGG + Intronic
1129005432 15:72369064-72369086 TTGTGTCCACATCTTGAGGCTGG - Intronic
1129302771 15:74635561-74635583 CTGTGTGGACCTCATGTGAAGGG - Exonic
1129906979 15:79195399-79195421 CTGTGGGCACATGCTGAGGAGGG - Intergenic
1130557683 15:84934294-84934316 GTGTGTGTACATGTTGAGGAGGG + Intronic
1130966048 15:88698796-88698818 CTATATGCACATCTAGACAAGGG + Intergenic
1131044860 15:89306128-89306150 CTGTGTGGACACCTTGTTAAAGG + Exonic
1132089458 15:98936041-98936063 ATGAGTGCACATCTTGCGCACGG - Intronic
1132245410 15:100292664-100292686 CAGTTTGCACATCTGTAGAATGG - Intronic
1133142414 16:3756789-3756811 CTCTATGAACATCTTGAAAAAGG + Intronic
1133503651 16:6389232-6389254 CTGTGGGCACAAGTTGGGAAAGG + Intronic
1133679976 16:8112363-8112385 CAGTGTTCTCATCTTGAAAATGG - Intergenic
1134183056 16:12062984-12063006 CTGTGTCCTCATCTGGAAAATGG + Intronic
1134380580 16:13720815-13720837 CTGTGTGCACATCTGTTAAATGG - Intergenic
1134470699 16:14522702-14522724 CTGTGTGCCCATCTTGATGCAGG - Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136048661 16:27635295-27635317 CTGTGAGGACAGCTTTAGAAAGG + Intronic
1136448371 16:30337778-30337800 CTGTGTCCTCATCTCGAGATGGG + Intergenic
1141007403 16:80365161-80365183 CTGTTTCCACATCTGGAAAATGG - Intergenic
1142804527 17:2364464-2364486 CTGTGTGCACCTCTTGGCTATGG + Intronic
1143933753 17:10460322-10460344 CTGTGTGAACAAGGTGAGAATGG + Intronic
1144025932 17:11275700-11275722 ATGTGTGACCATCTGGAGAAAGG + Intronic
1147946425 17:44082816-44082838 CTGCCTGCACCTCTTCAGAATGG - Exonic
1149138916 17:53405824-53405846 CTCTGTCCACATCTTCAGAAAGG + Intergenic
1150616425 17:66776008-66776030 CTGTGTGCATATCTGTTGAAAGG + Intronic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1153470169 18:5435616-5435638 TTGTGTGAACATCTTAAGAGTGG - Intronic
1155059008 18:22211933-22211955 GTGAGTGCCCATCTTGTGAAAGG - Intergenic
1155968859 18:32061752-32061774 GTCTGTTCACATCTTGAGTATGG + Intronic
1156136672 18:34048528-34048550 CTGGGTGCACTTCGAGAGAAAGG - Intronic
1157339804 18:46768978-46769000 ATGTCTGAACATCTTGGGAAAGG - Intergenic
1159031267 18:63234623-63234645 CTGTGTGCTCATCTGTAAAATGG + Intronic
1160077494 18:75692187-75692209 CTGTGTTCTCATCTGTAGAATGG + Intergenic
1161031659 19:2060567-2060589 CAGGGTGCACATCCTGGGAAGGG + Intergenic
1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG + Intronic
1161707448 19:5828853-5828875 CTGTGTGGACTTCTGGAGAGGGG + Intergenic
1164361052 19:27510929-27510951 CTTTTTGTACATCTTGAGAAGGG + Intergenic
1165923273 19:39311774-39311796 CTGTGTGCCCATCTTGTGTTGGG - Intronic
1167100649 19:47402522-47402544 CGGTTTCCACATCTGGAGAATGG - Intergenic
1168397996 19:56065302-56065324 GTGTGTACACATCTGGAGACAGG - Intergenic
925442882 2:3903605-3903627 CTCTGTGCACAACTAGAGAAAGG - Intergenic
925568108 2:5279046-5279068 CTGGGTGTTCAGCTTGAGAAAGG - Intergenic
926425554 2:12735962-12735984 CTGGGTGCTCATCTTGAGGTAGG + Intronic
927893332 2:26765835-26765857 CTGTGTTCAGATCCTGAGATGGG - Intronic
928170205 2:28998540-28998562 CTGAGTGGACATCTTGAGAGGGG - Intronic
929243035 2:39672205-39672227 CTGTGTGCAGATAGTAAGAATGG - Intronic
929330910 2:40679535-40679557 CTGTGTAAACATTTTTAGAAAGG + Intergenic
932477236 2:72013887-72013909 CTGTGTCCACATCTTCCCAACGG + Intergenic
932948218 2:76262385-76262407 TTGTGTGAACATGTTGAGCAGGG + Intergenic
933889129 2:86749845-86749867 CTGTTTTCACATCTAGAGATAGG + Intronic
934558708 2:95301091-95301113 CAGAGTGCCCATCTTGAGAGAGG - Intronic
935155056 2:100477475-100477497 TTGTCTGCACATATTAAGAAAGG - Intronic
935671917 2:105563193-105563215 CTGTGTCCACATCTGTAAAATGG - Intergenic
936328258 2:111524032-111524054 CTGTGTGCATAGCTGGAGATGGG + Intergenic
936418413 2:112341192-112341214 CTGTTTGCCCATCTTTAAAATGG - Intergenic
937656122 2:124378833-124378855 CTCTGTTTACATCTTGAGAAAGG + Intronic
939222030 2:139314661-139314683 CTGTGTGCAGTTCTTAAGAATGG + Intergenic
939392736 2:141589862-141589884 TAGGGTGCACATCTGGAGAAAGG + Intronic
940724765 2:157324340-157324362 CTGTGTGTGCACCTTGTGAAAGG - Intronic
940736341 2:157457061-157457083 CTGTGTGCTCATCTGTAAAATGG + Intronic
941219134 2:162753171-162753193 TTGTTTGCTCATCGTGAGAATGG + Intronic
942524678 2:176840609-176840631 ATGCATGCACATCATGAGAAGGG - Intergenic
943112864 2:183627531-183627553 GTGTGTGCACATGTTGATATAGG + Intergenic
943670933 2:190659578-190659600 CTGTGTGCAGAGCTTGGGACAGG + Exonic
945924683 2:215791208-215791230 CTGTGTTCTCAACTTTAGAATGG - Intergenic
947261018 2:228222433-228222455 TTCTGTGAACATCTTCAGAAAGG + Intergenic
948314833 2:237019747-237019769 CAGTTTGCACATCTTTAAAATGG - Intergenic
948610245 2:239162171-239162193 CTCTGTGCTCCTCTTCAGAAAGG + Intronic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1169934311 20:10866434-10866456 ATATGTCCACATCTTTAGAATGG + Intergenic
1170793617 20:19527739-19527761 CTTTGTGCAAATGTTCAGAAAGG - Intronic
1171185105 20:23119443-23119465 CAGTGTGCTCATCTTCAAAATGG - Intergenic
1172850492 20:37959164-37959186 CTGTGGGCACATTTTAATAAAGG + Intergenic
1173401120 20:42726757-42726779 GTGTGTGTGCATCTAGAGAATGG - Intronic
1174985905 20:55451731-55451753 CTGTGTGAACCCCTAGAGAAAGG - Intergenic
1175420285 20:58827999-58828021 CAGTGTAGACATCTTGAAAAAGG + Intergenic
1177282928 21:19008023-19008045 CAGGGTGCAGATCTTGAGATTGG - Intergenic
1178892727 21:36533489-36533511 CTCTGTGCCCATCCAGAGAATGG - Intronic
1179489956 21:41734666-41734688 CTGTGTGGAGCTCTTCAGAAAGG - Intergenic
1179564719 21:42240075-42240097 GTGTGTGCTCATCTTGGGACAGG + Intronic
1181132158 22:20738323-20738345 CTGTGTGCCCAACTTAAGCAGGG - Intronic
1181149130 22:20870221-20870243 CAGTGGGCACATCTGGAGACGGG - Intronic
1184794767 22:46725555-46725577 CTGTGGGAACATCTTGCAAAGGG + Intronic
950006541 3:9695167-9695189 CTGTGCCCACATACTGAGAAGGG - Intronic
950493869 3:13322220-13322242 CGGTGAACACATCTTGAGATGGG + Exonic
950583155 3:13876172-13876194 CTGTGGGAAGATCTGGAGAAGGG + Intronic
951308747 3:21098563-21098585 CTGTGTGCTCATCTGTGGAATGG - Intergenic
951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG + Intronic
952212515 3:31242495-31242517 CTGTTTGACCATATTGAGAAGGG - Intergenic
958045326 3:88277912-88277934 CTGTGTTCACATCAACAGAATGG - Intergenic
958970696 3:100607083-100607105 CTGTGTGGTCATCTGCAGAATGG - Intergenic
959557844 3:107742828-107742850 CTGTTTGCAAATCTTTAGGATGG - Intronic
961378144 3:126480571-126480593 CTGTGCACACATCTTAAGAGCGG - Intergenic
963043738 3:141087611-141087633 CTGTTTGCTCATCTGGAAAATGG - Intronic
964159412 3:153628792-153628814 CTGTGTTCTAAACTTGAGAATGG - Intergenic
966885799 3:184377559-184377581 CTCTTTGCACAACTTGTGAAAGG - Intronic
967564432 3:190957445-190957467 CTGTGCCTACAGCTTGAGAAAGG + Intergenic
969048701 4:4357129-4357151 CTGTGTGCACATCTGTAAAATGG + Intronic
969065701 4:4478786-4478808 CTGTGTTCAGATTTTGAGAAGGG + Intronic
969087345 4:4666273-4666295 CTGTTTGCATTTCTTGACAAAGG + Intergenic
969318540 4:6396380-6396402 CTGTTTGCTCATCTTTATAATGG - Intronic
969401254 4:6957073-6957095 CTGTGTGCTCCTCTTGAGGGTGG + Intronic
969555437 4:7905739-7905761 CTGTGTGTGCTTCTTGAGGAGGG - Intronic
975823205 4:78292634-78292656 CTGGGTGGACCTCTTGACAATGG + Intronic
988697218 5:33634392-33634414 CGGTGTGCACATGAAGAGAAGGG + Intronic
990114064 5:52367339-52367361 CTGTCTGCACATCTTGCCAGAGG - Intergenic
990389365 5:55303275-55303297 CAGTGTGTACATCTGCAGAATGG + Intronic
992556011 5:77904269-77904291 CTGTGTGGAGTTCTTGGGAAGGG - Intergenic
996111108 5:119567810-119567832 CTGTGTACTCATCTTTATAATGG - Intronic
996336166 5:122386602-122386624 CTGTGGGCACATCCAAAGAAGGG + Intronic
997486633 5:134236459-134236481 CTGTCTGCTTAGCTTGAGAAAGG + Intergenic
997755196 5:136389613-136389635 CTGTGTGCTCACATTTAGAATGG - Intronic
1000078668 5:157822021-157822043 ATGTGTGCAAAACTTGAGGATGG - Intronic
1000543685 5:162572071-162572093 ATATTTGCAAATCTTGAGAAAGG - Intergenic
1000602804 5:163295695-163295717 CTGGGTGCACATATTGGAAAAGG + Intergenic
1001263469 5:170254077-170254099 CTCTGTCCAGATCTTGAGTAAGG + Intronic
1001436311 5:171702455-171702477 CTTTGTGTACTCCTTGAGAAGGG - Intergenic
1002135240 5:177103730-177103752 CAGTGTCCACATCTGGAAAATGG - Intergenic
1002168251 5:177361254-177361276 CTGTGTGGACATCTCCAGACAGG + Intronic
1002282039 5:178136716-178136738 CTCTGTACCCTTCTTGAGAATGG + Intronic
1004261278 6:14109707-14109729 CTGTGTAAACTTCTTGAGAATGG + Intergenic
1005205289 6:23395840-23395862 CTGGGTGCACACCTTAGGAAGGG + Intergenic
1005637919 6:27768773-27768795 CAGCGGGCACAGCTTGAGAAAGG - Intergenic
1006055684 6:31382944-31382966 CTGTGTCCTCATCTTGAGGCTGG + Intergenic
1009648036 6:66433901-66433923 ATGTGTTTACATCTTGTGAATGG - Intergenic
1009815362 6:68726335-68726357 CTGTGTGCACATCTTGAGAAAGG - Intronic
1010668740 6:78660743-78660765 CTGTTTGCAAATCTTAAAAATGG + Intergenic
1011796956 6:90966444-90966466 CTTTGTGCACATTCTGAGATAGG + Intergenic
1013009085 6:106103938-106103960 CTGTCTGCACATCGCGAGGAAGG + Intronic
1013770552 6:113623330-113623352 CTGTGTGAACCTGGTGAGAAAGG - Intergenic
1015085208 6:129282553-129282575 CTGTGTGTATATGTTGAGCAAGG + Intronic
1018383180 6:163279086-163279108 CTTTTTGCACCTCTTGTGAAAGG + Intronic
1019567862 7:1693570-1693592 GTGTGTGCACATCTGCAGAGGGG + Exonic
1022179917 7:27909324-27909346 CTGTGTGTAAATCTTGGGTATGG + Intronic
1022611256 7:31875705-31875727 CTGTGTGCTCTTCTTTAGAAGGG - Intronic
1023566486 7:41528320-41528342 ATGTGTGCTCATCTTGGGAGTGG + Intergenic
1024246249 7:47472462-47472484 GTGTGTGCCCATCAAGAGAAAGG + Intronic
1026105482 7:67417559-67417581 CTGTGTGGACATAGTGAAAATGG + Intergenic
1028817610 7:95165369-95165391 CTGTGTGGGCATCTTCAAAAGGG - Intronic
1029296066 7:99541510-99541532 CTCTGTGCACATCTTCACATCGG + Intergenic
1030285362 7:107821119-107821141 CTATGAGCACATCCAGAGAATGG - Intergenic
1031025704 7:116677354-116677376 CTGTTTGCAAATCTTGATACAGG - Intronic
1031114451 7:117653031-117653053 GTGTGTGCACAACTTTAAAATGG + Intronic
1031934756 7:127725314-127725336 CTTTGTGCAAATTTAGAGAAGGG + Intronic
1035006921 7:155670606-155670628 CTGTTTTCACATTTTGAAAATGG + Intronic
1035503043 8:104584-104606 CTGTGTCAACAACTTGAGAGTGG + Intergenic
1036387870 8:8297452-8297474 CTGTTTGGCGATCTTGAGAAAGG + Intergenic
1036782418 8:11658783-11658805 CTGTTTTCTCATCTGGAGAATGG - Intergenic
1036928475 8:12930466-12930488 CTGTTTGCTGATCTTGAGATGGG + Intergenic
1037237045 8:16732390-16732412 CTCTGTGGACATATAGAGAAAGG - Intergenic
1037641672 8:20750007-20750029 ATGTGTCCACAGCTTGGGAATGG + Intergenic
1038284339 8:26193469-26193491 CTCTGTGCACGTGTTGGGAAAGG + Intergenic
1040665061 8:49621727-49621749 GTGAGTGCACACCTGGAGAAGGG - Intergenic
1043264485 8:78246671-78246693 GTGTGTGCACACCTTGATACAGG + Intergenic
1043809942 8:84726868-84726890 CTGTGTAAACTTCTTGAGGATGG - Intronic
1045303983 8:100940750-100940772 CTGTTTCCACATCTTCAAAATGG - Intronic
1046508185 8:115163487-115163509 ATGTGTGCACATCTTGTGAAAGG + Intergenic
1051325069 9:15957780-15957802 CTGTCTGAATGTCTTGAGAATGG + Intronic
1052255532 9:26451852-26451874 ATGTTTGCAAATCTTCAGAAGGG - Intergenic
1055697058 9:78896576-78896598 CTTTATGCACATCTGTAGAAGGG + Intergenic
1059015864 9:110514907-110514929 CTGTTCACAGATCTTGAGAAAGG + Intronic
1060824040 9:126677343-126677365 CTGAGAGAATATCTTGAGAAGGG - Intronic
1060928885 9:127475588-127475610 ATGTGTGCCAATCTTGAGGAAGG - Intronic
1061384303 9:130279298-130279320 CAGTTTCCACATCTTTAGAAAGG + Intergenic
1061677762 9:132228018-132228040 CAGTCTGCTCATCTGGAGAAGGG - Intronic
1193011963 X:76686902-76686924 CTTTGTGCTCAGCTTCAGAAGGG + Intergenic
1193431029 X:81405909-81405931 CTGTGTGCAAATTTTGAAGAAGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1198021924 X:132667353-132667375 CTCTTTGCACATTTTGAGATAGG - Intronic
1198047754 X:132919560-132919582 CTGTATGCAGATGTTAAGAAAGG - Intronic
1198553085 X:137764708-137764730 CTGTGAGTACTTCTGGAGAATGG - Intergenic
1199798548 X:151227245-151227267 CTGTGTGCAGAGCTTGGGACAGG - Intergenic
1201248470 Y:12030997-12031019 TTGTGTGCACTTTTTGACAAAGG - Intergenic
1201500720 Y:14639974-14639996 CTGGGCTCACATCTTGGGAAAGG - Intronic
1201597971 Y:15693584-15693606 CTGTGAACACAGCTTGACAAGGG + Intergenic