ID: 1009815987

View in Genome Browser
Species Human (GRCh38)
Location 6:68736118-68736140
Sequence CAGGAGAGGCTGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1678
Summary {0: 1, 1: 1, 2: 20, 3: 205, 4: 1451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009815987_1009815995 12 Left 1009815987 6:68736118-68736140 CCCTCCTGCTTCAGCCTCTCCTG 0: 1
1: 1
2: 20
3: 205
4: 1451
Right 1009815995 6:68736153-68736175 TAGGCACTTGCCAACATGACTGG 0: 1
1: 0
2: 69
3: 1313
4: 12214
1009815987_1009815993 -7 Left 1009815987 6:68736118-68736140 CCCTCCTGCTTCAGCCTCTCCTG 0: 1
1: 1
2: 20
3: 205
4: 1451
Right 1009815993 6:68736134-68736156 TCTCCTGTAGCTGGGACTATAGG 0: 3
1: 56
2: 1419
3: 20542
4: 153147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009815987 Original CRISPR CAGGAGAGGCTGAAGCAGGA GGG (reversed) Intronic
900018480 1:170734-170756 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900048738 1:529329-529351 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900070969 1:771153-771175 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900154727 1:1199323-1199345 CAGGGAGGGGTGAAGCAGGAGGG + Intergenic
900190995 1:1352154-1352176 GAGGAGTGGCGGGAGCAGGAAGG - Intergenic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900686852 1:3954282-3954304 CAGGAGAGGCTGGAGCAGGGCGG - Intergenic
901433079 1:9229868-9229890 CTGGAGAGGCTAAGGCAGGAGGG + Intergenic
901530868 1:9851773-9851795 CAGGACAGGCAGTGGCAGGAGGG + Intronic
901547411 1:9968829-9968851 CTTGGGAGGCTGAAGCAGGGAGG + Intronic
901657146 1:10775920-10775942 ACGGAGAGGCTGCAGCGGGAGGG - Intronic
901672798 1:10866153-10866175 CAGGAGAGGCGGAGGCGGGGTGG + Intergenic
901681534 1:10915733-10915755 CAGGTGGGTCAGAAGCAGGAGGG + Intergenic
901703404 1:11057399-11057421 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
901922872 1:12548802-12548824 CAGGTGAGGCTGAGGATGGAGGG - Intergenic
902073960 1:13767865-13767887 CATAGGAGGCTGAGGCAGGAGGG + Intronic
902315549 1:15616205-15616227 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
902396986 1:16137789-16137811 CAGGTGGGGCTTAAGGAGGACGG - Intronic
902430962 1:16362733-16362755 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
902515859 1:16989317-16989339 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903073287 1:20740013-20740035 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
903209162 1:21806584-21806606 CTTGGGAGGCTGCAGCAGGAAGG - Intergenic
903271595 1:22191927-22191949 GAGTAGCGGGTGAAGCAGGAAGG + Intergenic
903373872 1:22853782-22853804 AAGGGGAGGCTGAAGCAGGCCGG + Intronic
903378476 1:22881027-22881049 TTTGAGAGGCTGATGCAGGAGGG + Intronic
903428629 1:23274155-23274177 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
903432356 1:23316195-23316217 CCCGGGAGGCTGAAGCAGGAGGG + Intronic
903433899 1:23331724-23331746 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
903514471 1:23901443-23901465 CCGGGGAGGCTGCAGCAGGTCGG - Intronic
903626881 1:24737052-24737074 CTAGTGAGGCTGAAGCAGGAGGG - Intergenic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903763426 1:25715738-25715760 CAGGAGAGCCTGAGGCACTAAGG + Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904149304 1:28424297-28424319 CACAGGAGGCTGAGGCAGGAGGG - Intronic
904360729 1:29970077-29970099 AGGGAGAGGCTGGAGCAGCAGGG - Intergenic
904417334 1:30371396-30371418 CAGGAGAGAGTGGAGCAGGCTGG + Intergenic
904463016 1:30691613-30691635 CAACACAGGCTGACGCAGGAGGG + Intergenic
904519866 1:31086537-31086559 CTGGGGAGGCTGAGACAGGAAGG + Intergenic
904684815 1:32252270-32252292 CAGGCAGGGCTGAAGCGGGAGGG - Intronic
904716152 1:32469086-32469108 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
904768820 1:32870107-32870129 CAGGAGAGGCTGGGCAAGGACGG + Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
905436288 1:37957572-37957594 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
905448365 1:38042247-38042269 AATGAGAGGCTGAGGCAGGGTGG + Intergenic
905520322 1:38594009-38594031 CAGGTCAGTCTGGAGCAGGATGG + Intergenic
905634492 1:39540517-39540539 CAGGAGAGAATGATGCAGGCAGG + Intergenic
905699079 1:39998505-39998527 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
905749643 1:40450957-40450979 CAGGAGCTGCTGCAGCATGACGG - Exonic
905793676 1:40803423-40803445 CAGCAGAGGGAGAAGCAGAAGGG - Intronic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906331790 1:44891367-44891389 TTTGGGAGGCTGAAGCAGGAAGG - Intronic
906375759 1:45295379-45295401 CTTGGGAGGCTGATGCAGGAGGG - Intronic
906394126 1:45445685-45445707 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
906496210 1:46305644-46305666 CTCGAGAGGCTGAGGCAGAATGG + Intronic
906556499 1:46718622-46718644 CAGGAGAGGTGGCGGCAGGAGGG + Exonic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907087828 1:51693262-51693284 CTTAGGAGGCTGAAGCAGGAGGG + Intronic
907104228 1:51866112-51866134 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907298708 1:53471784-53471806 CTCCGGAGGCTGAAGCAGGAGGG - Intergenic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907468472 1:54655476-54655498 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
907512752 1:54973892-54973914 AAGGAGAGGCTGAATCAGTGTGG - Intergenic
907675273 1:56512096-56512118 CAGGAGGGGCCGGAGCAGGCGGG + Exonic
907794179 1:57698192-57698214 CTTGAGAGGGTGAAGAAGGAGGG - Intronic
907882691 1:58565874-58565896 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
908397870 1:63742817-63742839 AAGGAGAAGATGAAGCAGGGAGG + Intergenic
908401175 1:63774188-63774210 CAGGCGAGGCTGCAGCCAGAGGG + Exonic
908561770 1:65313158-65313180 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
908602967 1:65761294-65761316 CTGGAGAGGCTGAGACAAGAGGG - Intergenic
908733280 1:67248958-67248980 GAGGGGGGGCTGAAGCAGGGTGG - Intronic
908859444 1:68466450-68466472 CTACAGAGGCTGAGGCAGGAGGG + Intergenic
908872244 1:68626731-68626753 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
908876012 1:68676670-68676692 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
909344818 1:74572695-74572717 CAGGAGAGGCAGAGGCAAGCCGG - Exonic
909636662 1:77824316-77824338 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
909838267 1:80285432-80285454 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
910260365 1:85288284-85288306 CTTGGGAGGCTGAAGCAGGAAGG + Intergenic
910426432 1:87123769-87123791 CTGCAGAGGCTCCAGCAGGAGGG - Intronic
910672097 1:89783807-89783829 GAGGTGAGGCTGAAGAAGTAAGG + Intronic
910970140 1:92847977-92847999 CTTGAGAGGCTGAGGCAGGTGGG - Intronic
911272175 1:95815498-95815520 CAGGAGAGCCTGGAGAAGGAAGG + Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
911633795 1:100211877-100211899 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
911702134 1:100966118-100966140 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
912377779 1:109226098-109226120 CTAGGGAGGCTGAGGCAGGAGGG - Intronic
912467463 1:109883823-109883845 CCCCAGAGGCTGAAGGAGGAAGG + Intergenic
912614453 1:111084127-111084149 CAGGAGAGAGAGAAGCATGAAGG - Intergenic
912943286 1:114063731-114063753 CAGGAGATGCTGAAGCTGATAGG - Intergenic
913079193 1:115366007-115366029 CTGGAGAGGTTATAGCAGGATGG - Intergenic
913105382 1:115609544-115609566 CTTGAGAGGCTGAGGCAGGAAGG - Intergenic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913380302 1:118203085-118203107 CAGGAGAAGCTGGAGGAGAAAGG - Intergenic
914238967 1:145838573-145838595 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
914720733 1:150286732-150286754 CAGGAGATGCTGTAGTAGGTGGG - Exonic
914802289 1:150970601-150970623 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
914870335 1:151468345-151468367 CTGGAGAGGCTGAGGCGGGAAGG + Intergenic
914985896 1:152457021-152457043 CAGGAGAGGGTATGGCAGGAAGG + Intergenic
915038623 1:152949020-152949042 CAGGAGAGGCAGCACCAGGCTGG + Intergenic
915110302 1:153560358-153560380 CAGGAGATGATGCAGCAAGAAGG - Intergenic
915124114 1:153651267-153651289 CTTGAGAGGCTGAAGTGGGAGGG + Intergenic
915142359 1:153775505-153775527 CAGCAGGGGCAGCAGCAGGAGGG - Exonic
915199519 1:154216620-154216642 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915305828 1:154977486-154977508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915359872 1:155279432-155279454 CAGGAGATCATGAAGCAGCAAGG - Intronic
915713109 1:157920121-157920143 CAGCAGAGGATGAAGGAGAATGG - Intergenic
915944318 1:160138731-160138753 CTGGAGAGGCTGAGGCAAGAGGG + Intronic
916162385 1:161930980-161931002 CAGGAGAGACTGAACCTGGGAGG - Intronic
916327741 1:163582124-163582146 CTTGAGGGGCTGAAGTAGGAAGG + Intergenic
916427047 1:164690522-164690544 CATGGGAGGCCGAAGCAGAAGGG + Intronic
917246994 1:173014177-173014199 CATGTGAGGCTGCAGCAAGAAGG + Intergenic
917454446 1:175174050-175174072 CAGGACTGGGTGAAGCAGGCAGG - Intronic
917478105 1:175386141-175386163 CAGGGGAGGCTGCAGCCGGAAGG + Exonic
917512093 1:175677120-175677142 TAAGAGAGGCTGAAGAAAGAAGG + Intronic
917932425 1:179832082-179832104 GAGGTGATGCTGAAGCATGACGG - Intergenic
918315513 1:183319484-183319506 CAGGAGAGTCACAAGCAGGCTGG + Intronic
918352887 1:183675901-183675923 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
918425645 1:184407081-184407103 CTGGAGAGGCTAAAGCAAGGTGG - Intronic
918431453 1:184465011-184465033 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
918912604 1:190592847-190592869 GAGCAGAGGTAGAAGCAGGAGGG - Intergenic
919534772 1:198773898-198773920 TTTGAGAGGCTGAAGCAGGAGGG - Intergenic
919767611 1:201137254-201137276 TAGGGGAGGCTGAGGCTGGAAGG - Intronic
919791821 1:201296146-201296168 CAGGAGAGGCTGTGGGAAGAGGG + Intronic
919890729 1:201972268-201972290 TTTGGGAGGCTGAAGCAGGAAGG + Intergenic
920012846 1:202882135-202882157 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
920043314 1:203117730-203117752 CAGGAGAGGCTCGGGCAGGTGGG + Intronic
920105993 1:203554010-203554032 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
920143589 1:203839282-203839304 CTTGGGAGGCTGAAGAAGGATGG - Intronic
920221166 1:204402513-204402535 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
920241108 1:204551286-204551308 TTTGAGAGGCTGAGGCAGGAGGG - Exonic
920364273 1:205439933-205439955 GGGCAGAGGCTGAAGCTGGAAGG + Intronic
920379467 1:205527369-205527391 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
920893424 1:210018044-210018066 TAGGAGAGGCTAATCCAGGATGG + Intronic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921890161 1:220345816-220345838 CAGGAGGGGCAGGATCAGGAAGG - Intergenic
922126921 1:222736729-222736751 AAGGAAAGGTGGAAGCAGGAAGG + Intergenic
922223220 1:223624604-223624626 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
922281064 1:224124833-224124855 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
922426483 1:225500987-225501009 TATGACAGGCTGAAGCAGGTGGG - Exonic
922498113 1:226076542-226076564 TATAAGAGGCTGAGGCAGGAGGG + Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922730231 1:227945687-227945709 CAGGCGGGGCTGGAGCTGGAGGG - Intronic
922821188 1:228486999-228487021 CAGGAGTTACTGAAGTAGGAAGG + Intergenic
923152925 1:231250321-231250343 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
923207625 1:231774144-231774166 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
923342499 1:233019688-233019710 CAGGAGAGGTTGAGGCAGAGGGG + Intronic
923456066 1:234166673-234166695 CAGGATAGGAGGGAGCAGGAAGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923904010 1:238362343-238362365 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
924208917 1:241744600-241744622 AAGGAGAGCATGAAGCAGGCTGG + Intronic
924245317 1:242078337-242078359 CTTGGGAGGCTGGAGCAGGAGGG - Intergenic
924306329 1:242692720-242692742 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
924348513 1:243094168-243094190 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063146721 10:3301722-3301744 GAGCAGAGGCTGGAGCAGAAAGG - Intergenic
1063331006 10:5159479-5159501 CAGGAGAGGGTGAGGCAGAGAGG - Intergenic
1063342617 10:5282371-5282393 CAGGAGAGGGTGAGGCAGAGAGG - Intergenic
1063440511 10:6069154-6069176 CAGGATAGCCTGGAGCACGAGGG + Intergenic
1063816002 10:9772620-9772642 CTGAGGAGGCTGAAGCAGCAGGG - Intergenic
1063942352 10:11143108-11143130 GAGGAGAGGAAGAAGCACGAGGG - Intronic
1064193907 10:13230198-13230220 CTAGGGAGTCTGAAGCAGGAGGG + Intronic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1064689219 10:17896686-17896708 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1064714020 10:18156784-18156806 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1065042497 10:21711636-21711658 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065126784 10:22581486-22581508 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065217535 10:23463789-23463811 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1065353479 10:24816465-24816487 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1065698434 10:28401740-28401762 CATGAGAGTCAGAACCAGGATGG + Intergenic
1065789609 10:29248759-29248781 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1065834626 10:29645460-29645482 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065949440 10:30638611-30638633 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1066393044 10:34994175-34994197 CAGGAATGACTGAAGCAGGCTGG - Intergenic
1066537898 10:36411242-36411264 CATGGGAGGATGCAGCAGGAAGG + Intergenic
1066572376 10:36787647-36787669 CTCGGGAGGCTAAAGCAGGAGGG - Intergenic
1066727846 10:38410733-38410755 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1067188505 10:44050383-44050405 TTAGAGAGGCTGAGGCAGGAGGG - Intergenic
1067412097 10:46073875-46073897 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
1067666762 10:48285849-48285871 CAGGGGAGGGTGAAGAGGGATGG - Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1067949675 10:50720750-50720772 CAGGAGATGCTGAATAAAGATGG - Intergenic
1068293528 10:55036186-55036208 CATGAGATGATGAAGCAAGAAGG + Intronic
1068547001 10:58358866-58358888 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1068707378 10:60091836-60091858 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1068766786 10:60773375-60773397 CACGTGAGGCTGCAGCAAGATGG - Intergenic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1069626384 10:69870418-69870440 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1069902217 10:71712897-71712919 CACCAGAGGCGGAAGCAGGTGGG + Exonic
1070092240 10:73299313-73299335 CTAGGGAGGCTGAGGCAGGAGGG - Intronic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1070613759 10:77952977-77952999 CATGGGAGGCTGAAGCAGGAGGG + Intergenic
1070725964 10:78790795-78790817 CATGGGAGGCTGAGGCAGGAGGG - Intergenic
1070837002 10:79454364-79454386 CAGGAAAGCCAGTAGCAGGAAGG - Intergenic
1070884983 10:79885790-79885812 CAGGAGATGCTGAATAAAGATGG - Intergenic
1070946629 10:80397274-80397296 CAGGAGAGGCTGGAGAAGCTGGG + Intergenic
1070982166 10:80657748-80657770 TAGGAGAGGCAGATGCAGGTTGG - Intergenic
1070982894 10:80664321-80664343 CAGGAAAGGCTGCAGAGGGATGG + Intergenic
1071237427 10:83665415-83665437 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1071312299 10:84354089-84354111 CTGGGGAGGCTGAGGCGGGAGGG + Intronic
1071480532 10:86061669-86061691 CAGGAGGGACAGAAGCAGGCTGG - Intronic
1071499435 10:86193050-86193072 TAGGAGATGCTGAGGCTGGATGG - Intronic
1072108836 10:92298803-92298825 TATGGGAGGCTGAGGCAGGAGGG - Intronic
1072428401 10:95349933-95349955 CTGAGGAGGCTGAGGCAGGAGGG - Intronic
1072577846 10:96716891-96716913 AAGGGGAGGCTGTAGCAGCAGGG + Intronic
1072589643 10:96817794-96817816 TCGGAGAGGCTGAGGCAGAATGG - Intergenic
1072597225 10:96885487-96885509 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1072999013 10:100272029-100272051 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1073004269 10:100310225-100310247 TCGGGGAGGCTGAGGCAGGAGGG + Intronic
1073217840 10:101846344-101846366 CAGGAGAGGCTGCCAGAGGAGGG + Exonic
1073393392 10:103197921-103197943 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1073827047 10:107336420-107336442 CAGGAGAGGGAAGAGCAGGAAGG - Intergenic
1073945061 10:108740875-108740897 CAGCAGAGGCTGCAGTAGCAGGG - Intergenic
1074196594 10:111192525-111192547 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074413249 10:113245623-113245645 GAGGAGAGGCTGACTGAGGAGGG + Intergenic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074543853 10:114387389-114387411 CAGGGGAAGCTGAATCATGAAGG - Intronic
1074544619 10:114393072-114393094 AAGGAGAGGAGGAAGCAGGAAGG + Intronic
1074720874 10:116264105-116264127 CAAGAGAGGCTGCAGTAGGAAGG + Intronic
1074748346 10:116558300-116558322 CTTGGGAGGCTGAGGCAGGATGG - Intronic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1075024520 10:118974775-118974797 CTTGGGAGGCTGAAGCAGAATGG + Intergenic
1075152630 10:119948285-119948307 CTCGAGAGGCTGAGGCAGAATGG - Intergenic
1075273701 10:121075411-121075433 CCAGTGAGGCTGAAGCAGGGAGG + Intergenic
1075403406 10:122177459-122177481 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1075554648 10:123421621-123421643 CAGGAGTGGCTGAGGCTGGGGGG - Intergenic
1075657777 10:124173460-124173482 GGGCAGAGGCTGAAGGAGGAGGG - Intergenic
1075687017 10:124371314-124371336 CTGGAGAGCCTCAAGCAGAAAGG - Intergenic
1075725137 10:124607121-124607143 GCGGAGAGGGTGAAGCAGGAGGG - Intronic
1075888447 10:125923633-125923655 CTTGGGAGGCTGAAGCAAGAGGG - Intronic
1076055408 10:127368376-127368398 CAGGACAGGAAGAAGCAGCAGGG - Intronic
1076313987 10:129527918-129527940 GAGGAGAGACTGAGGCAGGCAGG - Intronic
1076393081 10:130118451-130118473 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076565894 10:131398852-131398874 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1076806789 10:132862791-132862813 CAGGAGAGGCTGGAGGGGGACGG + Intronic
1077022662 11:425834-425856 CTGGGGAGGCTGAGGCAGAATGG - Intronic
1077040825 11:521414-521436 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1077111903 11:865657-865679 CAGGTCGGGCTGAGGCAGGAGGG - Intronic
1077137175 11:1006270-1006292 CAGGAGGGGCCGAGGGAGGAGGG + Intronic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077325148 11:1960557-1960579 CAGGAGAGGCTGGAACACGGGGG - Intronic
1077325574 11:1962560-1962582 CAGGAGAGGCTGGAACACGGGGG - Intronic
1077466778 11:2737143-2737165 CAGGAGAGGAGGAGGCAGGCAGG + Intronic
1077519187 11:3021329-3021351 CAGGAAAGGCTGCAGCAGCCGGG - Intronic
1077590806 11:3489613-3489635 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1077633870 11:3828726-3828748 CTCGAGAGGCTGAGGCAGAATGG - Intronic
1077779600 11:5312022-5312044 GAGAAGAGGCTGAAGAGGGAAGG - Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078157565 11:8811839-8811861 CTTCAGAGGCTGAGGCAGGAGGG - Intronic
1078172491 11:8939045-8939067 TTGGAGAGGCTGAGGCAGGCGGG - Intergenic
1078200872 11:9181628-9181650 CTTGAGAGGCTGAGGTAGGAGGG + Intronic
1078313062 11:10265795-10265817 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
1078331567 11:10426377-10426399 GAGGACAAGCTGAAGCAGGGTGG - Intronic
1078429109 11:11274029-11274051 GAGGACAAGCTGAAGCAGGGTGG + Intronic
1078433140 11:11302939-11302961 CAGGAGAGGCTGAGCCCCGAGGG - Intronic
1078601365 11:12734025-12734047 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1078671551 11:13370208-13370230 CAAGAGAGCCTGTAGCAGCAGGG - Intronic
1079398322 11:20085084-20085106 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079497887 11:21066844-21066866 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079959566 11:26906446-26906468 CTCGAGAGGCTGAGGCTGGAGGG - Intergenic
1080080615 11:28214148-28214170 CTTGAGAGGCTGAGGCAGAAGGG - Intronic
1080346899 11:31335374-31335396 GAGGGGAAGCTGAAGCAGGGCGG - Intronic
1080856365 11:36115172-36115194 CAGCAGTGGCTGAAGCAGCCAGG - Intronic
1081551333 11:44115295-44115317 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1081672096 11:44948192-44948214 CAGGAGAGGCAGCTGCAGGGCGG - Intronic
1081698365 11:45135036-45135058 CTAGGGAGGCTGAGGCAGGAGGG + Intronic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081869275 11:46375984-46376006 CAGGAGGGGCTGAAGCAGCCGGG + Intronic
1082175116 11:49049626-49049648 CAGGTGATGCTGACGCAGGAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082771197 11:57208897-57208919 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1082820401 11:57541037-57541059 CTGGAGCCGCTGAACCAGGAAGG + Intergenic
1082858520 11:57831109-57831131 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1083186566 11:61021237-61021259 CTTGGGAGGCTGAAGCAGGGAGG + Intergenic
1083233764 11:61339191-61339213 CAGGAGGGGCTGCGGCAGGGAGG + Intronic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083263554 11:61535888-61535910 AAGGAAAGGCTGAAGAGGGAGGG + Intronic
1083331521 11:61900544-61900566 GAGGAGAGGCTGCGGCAGGAGGG + Intronic
1083497585 11:63071608-63071630 CAGAAGAAGCTAAATCAGGATGG + Intergenic
1083585107 11:63851336-63851358 TAGTGGAGGCTGAGGCAGGAGGG + Intronic
1083711821 11:64554393-64554415 CTGGAGAGGCCGAGGAAGGAAGG + Intergenic
1083723802 11:64618117-64618139 GAGGAGGCGCTGAAGCAGGCGGG - Intronic
1083857135 11:65398804-65398826 CGGAGGAGGCTGGAGCAGGACGG + Intronic
1084124877 11:67092807-67092829 CTCAAGAGGCTGAAGCAGGCTGG - Intergenic
1084133392 11:67155544-67155566 CCTGAGAGGCTGAGGCAGGAGGG - Intronic
1084246528 11:67861400-67861422 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1084330824 11:68429143-68429165 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
1084448875 11:69220838-69220860 CGGGCGAGGCTGAGGCAGGGTGG - Intergenic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084765043 11:71302745-71302767 CTGGAAAGGCTGAAGTGGGAGGG - Intergenic
1084826153 11:71733101-71733123 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1084956325 11:72693549-72693571 ATGGAGAGGCTGGGGCAGGATGG - Intronic
1085299518 11:75450078-75450100 CAGGAGAGGCCGATGGAGCAGGG + Intronic
1085356027 11:75837906-75837928 CTTTGGAGGCTGAAGCAGGAGGG + Intronic
1085407193 11:76270268-76270290 GAGGAGAGGCCGGAGCAGCAGGG - Intergenic
1085448339 11:76615898-76615920 TTGGAGGGGCTGAAGCAGGGTGG + Intergenic
1086383375 11:86283024-86283046 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1086690653 11:89786458-89786480 CAGGTGATGCTGACGCAGGAAGG - Intergenic
1086715147 11:90053202-90053224 CAGTTGATGCTGACGCAGGAAGG + Intergenic
1086957961 11:92953504-92953526 CAGGAGTGGCAGAGGCAGAAAGG + Intergenic
1087036090 11:93758153-93758175 CTGGAGCGGCTGCAGCAGGGAGG + Intronic
1087217125 11:95506213-95506235 CCAGAGAGGATGAAGCAGCATGG - Intergenic
1088011402 11:105005665-105005687 CAGCAGAGGCTGTGGCAAGAAGG - Intronic
1088015882 11:105059307-105059329 CAGCAGAGGTTGTGGCAGGAAGG - Intronic
1088173154 11:107019022-107019044 CAGGAGCTGCTCCAGCAGGATGG - Intergenic
1088214846 11:107496602-107496624 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1088321925 11:108563371-108563393 CAGGAGAGGCTGAGGAGGCATGG + Intronic
1088453887 11:110013506-110013528 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088735194 11:112723020-112723042 CAGGAGAGGCTGGTGGAAGATGG + Intergenic
1089409147 11:118224282-118224304 TGGGAAAGGCTGATGCAGGATGG - Intronic
1089422490 11:118342276-118342298 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1089487927 11:118861509-118861531 CAGGAGAGGAGGAAGAAGCAGGG + Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089607934 11:119652380-119652402 CTGGAGAGGCTGGGACAGGATGG - Intronic
1089657174 11:119957653-119957675 CATGGGAGGCTGAGCCAGGAGGG + Intergenic
1089688837 11:120173461-120173483 CAGCAGAGGCTGGAGCAGATGGG - Intronic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1089768027 11:120782698-120782720 TAGGGGGTGCTGAAGCAGGAGGG + Intronic
1090078870 11:123597332-123597354 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1090465014 11:126925812-126925834 CAGGAGAGGATGGAGAAGGCCGG - Intronic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1091129196 11:133129798-133129820 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1202808129 11_KI270721v1_random:15736-15758 CAGGAGAGGCTGGAACACGGGGG - Intergenic
1202808554 11_KI270721v1_random:17739-17761 CAGGAGAGGCTGGAACACGGGGG - Intergenic
1091682289 12:2535596-2535618 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092286259 12:7130653-7130675 CAGAAGGGGCAGCAGCAGGAGGG - Exonic
1092417090 12:8298521-8298543 CTCAACAGGCTGAAGCAGGAGGG - Intergenic
1092611493 12:10178001-10178023 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1092624315 12:10310225-10310247 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1093078177 12:14778597-14778619 GAGGAGAGGATGCAGCCGGAAGG + Intergenic
1093200237 12:16177758-16177780 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094111395 12:26866458-26866480 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1094129477 12:27060113-27060135 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1094363696 12:29657861-29657883 TTGGAGAGGCTGAGGCAGGTGGG + Intronic
1094465812 12:30753601-30753623 CAGATGAGGCTGAAGGAGGTGGG + Exonic
1094687536 12:32732986-32733008 CTGGGGAGGCTGAGGCAGGCAGG + Intronic
1094741906 12:33299298-33299320 CTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1095250748 12:39976638-39976660 CTTGGGAGGCTGAAGCAGGAAGG - Intronic
1095394162 12:41743453-41743475 CTTGGGAAGCTGAAGCAGGAGGG - Intergenic
1095583343 12:43824819-43824841 CTGGGGAGGCTGAGGCAGAATGG + Intergenic
1095616389 12:44194721-44194743 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1095882914 12:47157480-47157502 CTGGGGAGGTTGAGGCAGGAAGG + Intronic
1096028624 12:48390652-48390674 CAGGAGATGCTCAAGGAGAATGG - Intergenic
1096332544 12:50726741-50726763 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1096367154 12:51037796-51037818 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
1096390953 12:51228785-51228807 CTTGAGAGGCTGAGGCAAGAGGG - Intergenic
1096441599 12:51648308-51648330 CTGAGGAGGCTGAGGCAGGAGGG - Intronic
1096618677 12:52848831-52848853 CAGGGGAGGCTTCAGCAGCAGGG - Exonic
1096633756 12:52945813-52945835 CGGGAAAGGGTGGAGCAGGAGGG - Intronic
1096649247 12:53053815-53053837 AAGGTGATGCTGGAGCAGGAGGG + Intronic
1096972210 12:55676134-55676156 CTCAAGAGGCTGAAGCAGGAAGG + Intergenic
1097003559 12:55898917-55898939 TTTGAGAGGCTGAAGCAGGCAGG + Intergenic
1097178214 12:57155841-57155863 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1097445702 12:59668375-59668397 CAGGACATGCTGATGCAAGAGGG - Intronic
1097892606 12:64793095-64793117 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098229217 12:68355894-68355916 CTTGAGAGGCTCAAGCAGGAGGG - Intergenic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1098357379 12:69624424-69624446 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1099058445 12:77874451-77874473 TTTGAGAGGCTGAGGCAGGAAGG - Intronic
1099587857 12:84544634-84544656 CTGGAGAGGCTGAGGCAGAATGG - Intergenic
1100404309 12:94260158-94260180 TTGGGGAGGCTGAGGCAGGAGGG - Intronic
1100480997 12:94979118-94979140 CATGGGAGGCTGAGGCAGGGGGG + Intronic
1100988876 12:100231065-100231087 CTGGGGAGGCTAAAGCAGGCAGG - Intronic
1101771823 12:107759163-107759185 CAGGGGAGGCTGAAGTGGGGAGG + Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1101950980 12:109174760-109174782 CTGAGGAGGCTGAGGCAGGAGGG + Intronic
1102318645 12:111911805-111911827 CACAAGAGGCTGAAGTAGGAGGG - Intergenic
1102879387 12:116472612-116472634 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1102943752 12:116966824-116966846 CTCGGGAGGCTGAGGCAGGAAGG - Intronic
1102972719 12:117182983-117183005 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1102978221 12:117221751-117221773 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1103092544 12:118107591-118107613 CTTGAAAGGCTGAGGCAGGAGGG + Intronic
1103122199 12:118389621-118389643 CTCGAGAGGCTGAGGCAGGTAGG - Intronic
1103270568 12:119669679-119669701 CTCGGGAGGCTGAGGCAGGATGG - Intronic
1103460609 12:121101800-121101822 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1103503792 12:121426551-121426573 CTGGGGAGGCTGAGGCGGGAGGG - Intronic
1103513110 12:121488914-121488936 CTCGAGAGGCTCAGGCAGGAAGG - Intronic
1103592977 12:122005435-122005457 AAGGAGATGCTGAAGCCGGATGG - Intergenic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1103638423 12:122328687-122328709 CTGGGGAGGCTGAGGCAGAATGG - Intronic
1103791748 12:123477017-123477039 CAGGAGAGACTGAAGCAGAGGGG + Intronic
1104007306 12:124902676-124902698 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1104067885 12:125320159-125320181 CATGAGGGGCTCCAGCAGGACGG - Intronic
1104154739 12:126120583-126120605 AAGGAGGGGCTGCAGCATGAAGG - Intergenic
1104195282 12:126531239-126531261 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1104234613 12:126921486-126921508 TATGGGAGGCTGAGGCAGGAGGG - Intergenic
1104689376 12:130813822-130813844 CAGAAGTTGCTGAAACAGGAAGG + Intronic
1104720850 12:131044399-131044421 CAGGAGAGGCAGAAGCACAGGGG + Intronic
1104830502 12:131747622-131747644 CAGGAGGTGCTGCAGCTGGAGGG + Intronic
1104953663 12:132453647-132453669 CTGGAGAGGCTGGCCCAGGAAGG - Intergenic
1105018964 12:132803925-132803947 AAGGAGAGGGCGAAGCAGGGTGG - Intronic
1105024058 12:132837038-132837060 GAGGAGAGGCTGCAGAGGGAGGG + Intronic
1105220098 13:18317738-18317760 CTTGGGAGGCTGAAGCAAGAGGG + Intergenic
1105392814 13:19996776-19996798 CTTGGGAGGCTGAAGCTGGAAGG + Intronic
1105472901 13:20707765-20707787 TATGAGAGGCTGAGACAGGAGGG - Intronic
1105510140 13:21044835-21044857 CATGGGATGCTGAGGCAGGAGGG - Intronic
1105581075 13:21697254-21697276 CACAGGAGGCTGAGGCAGGAAGG - Intronic
1105796346 13:23857460-23857482 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1105938427 13:25123992-25124014 CACGGGAGGCTGAGGTAGGAGGG + Intergenic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106174610 13:27319349-27319371 TTTGAGAGGCTGACGCAGGAGGG - Intergenic
1106234187 13:27847864-27847886 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1106498325 13:30303455-30303477 CTGGGGAGGCTGAGACAGGAAGG + Intronic
1106526787 13:30547807-30547829 CTTGGGAGGCTGAAGCAGGGAGG + Intronic
1106657993 13:31767916-31767938 CACTAGAGGCTCAAGCAGGAGGG + Intronic
1107402670 13:40084661-40084683 TTGGAGTGGCTGAATCAGGATGG - Intergenic
1107550313 13:41468401-41468423 CAGGAGAGTGAGGAGCAGGAAGG - Intronic
1107585835 13:41847508-41847530 CAGTAGAGGGTCCAGCAGGAAGG + Intronic
1107966298 13:45601306-45601328 CTTGGGAGGCTGAAGCGGGAAGG + Intronic
1108025125 13:46169690-46169712 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1108113016 13:47097553-47097575 CAGGAGATGGTGAAGCAAAAAGG + Intergenic
1108195447 13:47990103-47990125 TTTGAGAGGCTGAAGCAGGCGGG + Intronic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1108698594 13:52924829-52924851 GAGGAGAGGCAAAAGCTGGAAGG + Intergenic
1108944250 13:56002072-56002094 AAGGAGAGGCCCAAGCAGAAGGG + Intergenic
1110273377 13:73616127-73616149 CAGATCAGGCTGAAGAAGGATGG + Intergenic
1110284629 13:73735187-73735209 CTTGGGAGGCTGAAGCAGGAAGG + Intronic
1110439372 13:75510028-75510050 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1110589324 13:77236788-77236810 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1111355128 13:87089572-87089594 GAGGAGATGTTGAAACAGGATGG - Intergenic
1111771272 13:92599290-92599312 CAGGAAAGGCTTTTGCAGGAAGG + Intronic
1111883235 13:93985327-93985349 CTTGAGAGGCTGAGGCAGGAAGG + Intronic
1112029066 13:95440431-95440453 TTGGGGAGGCTGAAGCAGGAGGG + Intronic
1112036500 13:95501419-95501441 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1112137794 13:96602109-96602131 CAGCTGTGGCTGAAGCAGGTGGG + Intronic
1112248771 13:97758626-97758648 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1112295673 13:98184648-98184670 CACCAAAGGCGGAAGCAGGATGG - Intronic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1112601018 13:100856088-100856110 GAGGAGAGGTTGAAACAGTAGGG - Intergenic
1112845048 13:103631699-103631721 GTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1113475332 13:110576475-110576497 CTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1113545114 13:111142763-111142785 GAGGAGATGGTGAAGCAGGAGGG - Intronic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1113931979 13:113973529-113973551 AGGGACAGCCTGAAGCAGGAGGG - Intergenic
1113981107 13:114276745-114276767 GAGGACAGGCTGCAGCAGGTAGG + Intergenic
1114178175 14:20342818-20342840 CTTGGGAGGCTGAAGCAGAATGG - Intergenic
1114604845 14:23988433-23988455 CAGGTGAGGCTGGAGCAGCCTGG - Intronic
1114610291 14:24035980-24036002 CAGGTGAGGCTGGAGCAGCCTGG - Intergenic
1114835282 14:26196579-26196601 CAGGAGGGGCTTAAGCAATAGGG - Intergenic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1115546010 14:34465324-34465346 CAGGAGAAGCTAATGGAGGAAGG + Intergenic
1115618534 14:35119443-35119465 CTCGAGAGGCTGAAGCAGGGAGG - Intronic
1116114832 14:40634929-40634951 CAGGAGGTGGTGAAGCAAGATGG + Intergenic
1116562287 14:46395627-46395649 CTGGGGAGGCTGAGGCAGAATGG + Intergenic
1117139649 14:52775772-52775794 CTGGGGAGGCTGAGGCAGGAGGG + Exonic
1117381203 14:55165413-55165435 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1117443375 14:55780440-55780462 CAGGGGAGGGTCAGGCAGGAGGG - Intergenic
1117530105 14:56652388-56652410 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
1117689836 14:58295255-58295277 CTGGGGAGGCTGAGGCAGAATGG + Intronic
1117717488 14:58595952-58595974 CTCCAGAGGTTGAAGCAGGAGGG - Intergenic
1118214772 14:63798499-63798521 CTCGAGAGGCTGAGGCAGGAGGG - Intergenic
1118633008 14:67723339-67723361 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118715828 14:68559486-68559508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118765506 14:68906878-68906900 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1118771752 14:68946949-68946971 CAGGTGAGACTGAAGCTTGAAGG - Intronic
1118915175 14:70096761-70096783 GAGGAGAGGCTGTGGCAGGTGGG + Intronic
1119303050 14:73585895-73585917 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1119312090 14:73656666-73656688 CATGGGAGGCTGAGGCAAGAGGG - Intronic
1119555157 14:75547362-75547384 CTAGGGAGGCTGAAGCAAGAGGG - Intergenic
1119558651 14:75572430-75572452 CAGGAGAGGCTGCAGCAGGGTGG + Intergenic
1119663946 14:76470933-76470955 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1120002842 14:79323139-79323161 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1120531229 14:85633690-85633712 CTTGGGAGGTTGAAGCAGGAGGG + Exonic
1120815618 14:88854788-88854810 CTTGGGAGACTGAAGCAGGATGG - Intronic
1120967959 14:90184293-90184315 CAGGAGAGCCTGAAGGATGCGGG + Exonic
1121113071 14:91325682-91325704 TGGGAGAGACTGAGGCAGGAGGG - Intronic
1121150348 14:91627723-91627745 GAGGAAAGCCTGAGGCAGGAGGG + Intronic
1121332353 14:93057692-93057714 GAGGAGAGGCAGAACCAGCAGGG + Intronic
1121348190 14:93151772-93151794 AAGGAGAGGTTGATGCAGGCAGG - Intergenic
1121400678 14:93674332-93674354 TAGGGGAGGCTTAGGCAGGATGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121538820 14:94710202-94710224 CAGGAGATTCTGAAGCACTATGG - Intergenic
1121642359 14:95494322-95494344 CAGGAGAGGCTCATAGAGGAAGG + Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122092351 14:99348902-99348924 CAGGACAGGGGGAAGCAAGAAGG + Intergenic
1122473200 14:101986260-101986282 GGGCAGAAGCTGAAGCAGGATGG + Exonic
1122479982 14:102040849-102040871 CTCGGGAGGCTAAAGCAGGAAGG + Intronic
1122491602 14:102120119-102120141 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1122501580 14:102203653-102203675 CAGGAGTGGCAGAAGCACCAGGG - Intronic
1122614486 14:103007754-103007776 CGGGAGAGGATGGAGCATGATGG + Intronic
1122740930 14:103871343-103871365 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
1122971369 14:105153568-105153590 CTGGAGAGGCGGCGGCAGGAAGG + Intronic
1123681187 15:22765437-22765459 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1123690071 15:22831237-22831259 CCGGGGAGGCTGACGCAGGAGGG - Intergenic
1124333400 15:28839899-28839921 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1124908781 15:33897772-33897794 CTTGAGAGGCTGAGGTAGGAGGG + Intronic
1125431467 15:39599031-39599053 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
1125677309 15:41509336-41509358 CAGGAGGGGCTCAGGCAGGCAGG - Intronic
1125722977 15:41853944-41853966 GAGAAGAGGCTGAAGCAGGCTGG + Intronic
1125819916 15:42620371-42620393 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1125824171 15:42661550-42661572 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1125860622 15:42996137-42996159 CAGTAGGGGCTGAAGTAGTAAGG - Intronic
1125987871 15:44073024-44073046 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1126015199 15:44344015-44344037 CTGGATAGGCTGAGGCGGGAGGG + Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126112227 15:45182082-45182104 CAGGAGAGGCTTGAGCAGGAAGG - Intronic
1126410122 15:48364834-48364856 CTGGAGAGGCTGAACCAGCAGGG - Intergenic
1126653696 15:50953480-50953502 CAGAGCAGGATGAAGCAGGATGG - Intronic
1126752976 15:51895998-51896020 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1126791681 15:52227300-52227322 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1127144686 15:56012139-56012161 CTCGTGAGGCTGAGGCAGGAAGG + Intergenic
1127164316 15:56229045-56229067 AAGGACAGGATGGAGCAGGATGG + Intronic
1127271698 15:57407563-57407585 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
1127503507 15:59576632-59576654 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1127523009 15:59761937-59761959 CTGGGGAGGCTGAGGCAGGAAGG - Intergenic
1127585702 15:60376050-60376072 CTGTAAAGGCTGAAGCAGGGAGG + Intronic
1127599618 15:60522465-60522487 TTTGAGAGGCTGAGGCAGGAAGG + Intronic
1127833298 15:62769659-62769681 CAGGAGAGGGTGGAGGATGATGG - Intronic
1128071032 15:64797360-64797382 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128120577 15:65143016-65143038 CTTCAGAGGCTGAAGCAAGAAGG - Intergenic
1128270559 15:66305630-66305652 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1128395978 15:67226238-67226260 TTGGGGAGGCTGAAGCAGGAAGG - Intronic
1128542168 15:68543773-68543795 CAGGAGGGACTAAGGCAGGAAGG - Intergenic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1128654432 15:69450181-69450203 TTTGAGAGGCTGAAACAGGATGG + Intergenic
1128925053 15:71647856-71647878 TAGGAGATGCTGAAGCAGTGTGG + Intronic
1128944560 15:71811848-71811870 CAGGCGGGGATGAACCAGGACGG + Exonic
1129006607 15:72378909-72378931 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1129048923 15:72761804-72761826 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1129277889 15:74459414-74459436 CCTGGGAGGCTGAGGCAGGAAGG - Intronic
1129425643 15:75460577-75460599 CTCAAGAGGCTGAGGCAGGAAGG + Intergenic
1129484092 15:75852217-75852239 CAGGAAAGGCTTAAAAAGGAAGG - Intronic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1129810322 15:78505215-78505237 CTCGGGAGGCTGAAGCAGAATGG - Intergenic
1129839477 15:78734882-78734904 CAGAAGAGGCTGGGGGAGGAGGG + Intergenic
1130042559 15:80417607-80417629 CAGGAGAGGGTGAGGAGGGAAGG - Intronic
1130417285 15:83705614-83705636 CATCAGTGGCTGATGCAGGACGG + Intronic
1130580355 15:85132212-85132234 CTTGAGAGGCTAAGGCAGGAGGG - Intronic
1130616840 15:85418181-85418203 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1131019483 15:89086520-89086542 GTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131099783 15:89678951-89678973 CATGAGAGGCTGAGGTGGGAGGG - Intronic
1131254927 15:90855681-90855703 TTGGGGAGGCTGAAGCAGGTGGG + Intergenic
1131416184 15:92260646-92260668 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1131513194 15:93060894-93060916 TAGGAAAGGCTGAAGTAGGGCGG + Intronic
1131727180 15:95239414-95239436 CAGGAGGGGGAGAAGAAGGAAGG + Intergenic
1132219559 15:100095142-100095164 AAGGAGAGGCAGGAGCAGGTTGG - Intronic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1132686497 16:1164437-1164459 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1132739228 16:1403058-1403080 CAGCAGAGCCTGCAGCAGCAGGG + Intronic
1132820050 16:1861648-1861670 CTAAGGAGGCTGAAGCAGGAGGG - Intronic
1133013036 16:2925396-2925418 CGGGTGAGGCTAAACCAGGAAGG - Intronic
1133213648 16:4277245-4277267 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1133356180 16:5138701-5138723 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1133405746 16:5523176-5523198 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1133463538 16:6008095-6008117 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1133497794 16:6336301-6336323 CACGGGAGGCTGAGGCAGAATGG - Intronic
1133620709 16:7523635-7523657 CATTAGGGGCTGAAGCAGGTGGG + Intronic
1133835698 16:9365542-9365564 CAGGAGAGGCTGGTGCAGGAAGG + Intergenic
1134002957 16:10796945-10796967 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1134027206 16:10963584-10963606 GTGGAGGGACTGAAGCAGGAGGG - Intronic
1134063832 16:11214108-11214130 CTTGGGAGGGTGAAGCAGGAGGG + Intergenic
1134129732 16:11641099-11641121 CATGGGAGGCTGGGGCAGGAGGG + Intergenic
1134237940 16:12482407-12482429 CTTGGGAGGCTGAAGCAAGAGGG - Intronic
1134252599 16:12584979-12585001 CATGAGAGACTGAAGGAGCAGGG - Intergenic
1134303275 16:13010068-13010090 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1134448686 16:14349822-14349844 CTGGGGTGGCTGAGGCAGGAGGG - Intergenic
1134776610 16:16859006-16859028 CTCGGGAGGCTGAAGCAGGAGGG - Intergenic
1134823671 16:17267099-17267121 CAGCACAGGGTGAGGCAGGAAGG + Intronic
1135031480 16:19042280-19042302 CTCGAGAGACTGAGGCAGGAGGG - Intronic
1135117493 16:19735956-19735978 CTCAAGAGGCTGAGGCAGGAAGG + Intronic
1135382268 16:22005030-22005052 CAGAAGAGGCTGAATCCAGATGG - Intergenic
1135415673 16:22266571-22266593 GAGGAGAGGCTGGAGCTGGGGGG - Intronic
1135525103 16:23208237-23208259 TCAGAGAGGCTGAGGCAGGAAGG + Intronic
1135614940 16:23903071-23903093 TTGGGGAGGCTGAAGCAGGAGGG - Intronic
1136463368 16:30425699-30425721 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1136479630 16:30533447-30533469 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136483408 16:30556406-30556428 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1137385682 16:48040633-48040655 CCCGGGAGGCTGAGGCAGGAGGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1137846606 16:51695962-51695984 CTGGAGAGGCTGAAGTGGAAGGG + Intergenic
1138333285 16:56232162-56232184 TAGGAGAGGCTGCAGGAGGGAGG - Intronic
1138447513 16:57073699-57073721 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1138658371 16:58503466-58503488 CAGGAGGGGCTGCTGCAAGATGG + Intronic
1139407853 16:66733595-66733617 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1139461910 16:67129195-67129217 CAGGAGGGGCTGTGGAAGGAAGG - Intronic
1139598023 16:67969150-67969172 CAGGAGAGGCTGCAGCTAGAGGG - Intronic
1139613140 16:68073109-68073131 CTGTGGTGGCTGAAGCAGGAAGG + Intronic
1139618579 16:68117613-68117635 CCTGAGAGGCTGAGGCAGGAGGG - Intronic
1139787018 16:69401587-69401609 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1140733826 16:77880262-77880284 CTTGGGAGGCTGAAGCAGGAGGG - Intronic
1141082117 16:81061707-81061729 CAGGGGAGGCAGAACTAGGAGGG + Exonic
1141433023 16:83980682-83980704 CAGAAGAGGGTGCAGCAGGTAGG - Intronic
1141571804 16:84938638-84938660 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1141844970 16:86602190-86602212 CTCGGGAGGCTGAGGCAGGATGG - Intergenic
1141911581 16:87063228-87063250 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1141965806 16:87442181-87442203 CAGCAGAGTCTGAGGCTGGACGG + Intronic
1141985632 16:87577864-87577886 CTCAAGAGGCTGAGGCAGGATGG + Intergenic
1142445178 16:90131729-90131751 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1203143820 16_KI270728v1_random:1786438-1786460 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1142514285 17:416888-416910 CAGGAGAGAGTGGAGCAGGAAGG + Intronic
1142525761 17:539589-539611 CCAGGGAGGCTGAGGCAGGAGGG + Intronic
1142537031 17:625352-625374 CTTGGGTGGCTGAAGCAGGAGGG + Intronic
1142546216 17:705344-705366 TCGGAGAGGCTGAGGCAGGAGGG + Intronic
1142597742 17:1037725-1037747 CAGGAGGGGCTGAGGCCTGAAGG + Intronic
1142674517 17:1505478-1505500 GAGGCCAGGCTGCAGCAGGATGG - Intronic
1143011192 17:3867146-3867168 CAGGGGAGGCTGAAGCTACAGGG + Intronic
1143197842 17:5089761-5089783 CTGGGGAGGCTGAGGTAGGAGGG - Intronic
1143332348 17:6147018-6147040 CAGGAGAGGCTGTACTAGGTTGG - Intergenic
1143365165 17:6403274-6403296 CTCAAGAGGCTGAAGCTGGAGGG - Intronic
1143378300 17:6480121-6480143 CAGCAGTGGCTGATTCAGGAGGG - Intronic
1143592297 17:7892898-7892920 CACCTGAGGCTGAGGCAGGAGGG - Intronic
1143870279 17:9953310-9953332 AAGGAGTGGCAGAAGCAGCAGGG - Intronic
1144085715 17:11806932-11806954 GAGGAGAGGCTGATGGAGGGTGG + Intronic
1145409234 17:22641843-22641865 CGTGAGAGGCTGAGGCAGAAGGG - Intergenic
1145722261 17:27083955-27083977 CAGCAGACCCTGCAGCAGGAAGG + Intergenic
1145756030 17:27390601-27390623 CAGGAAAGGCCAAGGCAGGATGG - Intergenic
1145985120 17:29040769-29040791 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1146271093 17:31486517-31486539 TATGAGAGGCCAAAGCAGGAGGG - Intronic
1146421105 17:32686755-32686777 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1146832222 17:36080014-36080036 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1147017749 17:37506155-37506177 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1147163220 17:38579593-38579615 GAGGAGAGACTGAAGAAGGGAGG - Intronic
1147317275 17:39626976-39626998 GAGGAGAGGCTGAGGGAGGGAGG + Exonic
1147392631 17:40119827-40119849 CTGGGGAGGCTGAGGCAGAATGG + Intergenic
1147592881 17:41696330-41696352 AATGAGAGGCTTGAGCAGGAGGG - Intergenic
1148136578 17:45296415-45296437 CTTGGGAGCCTGAAGCAGGAGGG + Intronic
1148435591 17:47681938-47681960 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
1148766091 17:50039155-50039177 CAAGAGTGGGTGAAGCAGGTTGG - Intergenic
1149108367 17:52996689-52996711 GAGGAGAAGGTGAAGCATGATGG + Intergenic
1149323932 17:55510486-55510508 CATGGGAGGCTGAAGTGGGAAGG + Intergenic
1149534466 17:57421747-57421769 CATGGGAGGCTAAAGCAGGAGGG + Intronic
1149548766 17:57524113-57524135 CAGGCTAGCCTGATGCAGGATGG - Intronic
1149795434 17:59514799-59514821 GAAGAGAGGCTGAATCAGAAAGG + Intergenic
1149864671 17:60144618-60144640 TTTGAGAGGCTGAGGCAGGAAGG - Intergenic
1149867124 17:60157206-60157228 CAGGAGAGGGGGAGGCAGGCAGG + Intronic
1149955292 17:61042780-61042802 CCTGGGAGGCTGAGGCAGGAGGG + Intronic
1149974931 17:61256076-61256098 CAGTAGAGGCTGATGGAGGCTGG - Intronic
1150055391 17:62010112-62010134 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1150226692 17:63528298-63528320 CAGGAGTGGGTGAAGCAGGCAGG + Intronic
1150444607 17:65219031-65219053 CAGCAGAGGCTAAAGCAGAGGGG + Intronic
1151190605 17:72395076-72395098 CAGTAGAGGGAGAAACAGGAAGG + Intergenic
1151353132 17:73543238-73543260 GAGGAGAGGCTGGAGTGGGATGG + Intronic
1151362967 17:73599625-73599647 GAGGAAAGGATGAAGAAGGAGGG + Intronic
1151386925 17:73760642-73760664 CAGGAGGGGCTCAAGTGGGAGGG + Intergenic
1151416628 17:73970519-73970541 CAGCAGAGGCTGCATCAGGAGGG - Intergenic
1151446867 17:74172070-74172092 CTTGGGAGGCTGAAGTAGGAGGG + Intergenic
1151490266 17:74428707-74428729 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
1151761091 17:76103628-76103650 GAGGACAAGCTGAAGCAGGTGGG - Exonic
1151787472 17:76282123-76282145 CAGGAGAGACGGCAGCAGCAGGG + Intronic
1151818182 17:76481844-76481866 CTCGGGAGGCTGAGGCAGGATGG + Intronic
1151850554 17:76687229-76687251 CAGCACAGCCTGAAGCAGGAGGG - Intronic
1151918752 17:77138502-77138524 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1151925674 17:77194445-77194467 CTGGGGAGGCTGAGGTAGGATGG + Intronic
1152094500 17:78265281-78265303 CAGGACAGGCTGCAACAGAAAGG + Intergenic
1152143127 17:78550301-78550323 GAGGACAGGCTCATGCAGGAAGG + Intronic
1152327293 17:79648850-79648872 TGGGAGAGGCTGGAGCAAGAGGG - Intergenic
1152445675 17:80341456-80341478 AAGGAGAGGCTTCAGCAGGGAGG - Intronic
1152732718 17:81980514-81980536 CAAGAGAGACTGGAGAAGGATGG - Intronic
1152780101 17:82223618-82223640 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1152845669 17:82598335-82598357 CAAGAGAGGCTGAGGCAGGCGGG - Intronic
1153273560 18:3346892-3346914 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1153283402 18:3435302-3435324 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1153460564 18:5328276-5328298 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1153842753 18:9021945-9021967 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1153856100 18:9148894-9148916 AAAATGAGGCTGAAGCAGGAAGG - Intronic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154021169 18:10665147-10665169 CAGGACAGGGTGGAGCTGGAGGG + Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154274994 18:12950927-12950949 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155044396 18:22091077-22091099 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1155146322 18:23086646-23086668 CAGGTGAGGCTACAGCAGGCAGG - Intergenic
1155152336 18:23133260-23133282 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1155309591 18:24510617-24510639 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1155386171 18:25280176-25280198 TGGGAGAGTCTGAGGCAGGAGGG - Intronic
1155492175 18:26410202-26410224 CCTGAGAGGCTGAGTCAGGAGGG - Intergenic
1155503887 18:26514308-26514330 CTTGGGAGGCTGAAGTAGGAGGG + Intronic
1155788639 18:29934799-29934821 CTGGGGAGGCTGAGGCAAGAAGG + Intergenic
1155972589 18:32095275-32095297 CTTGAGAGGCTGAGGCGGGAGGG - Intronic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1156491815 18:37500888-37500910 CTGGGGAGGCTGAAGCACGTAGG + Intronic
1157358372 18:46955657-46955679 CTCCAGAGGCTGAAGCAGGAGGG - Intronic
1157398386 18:47364101-47364123 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157601456 18:48895524-48895546 CATGGGAGGCTGAGGCAGGGTGG - Intergenic
1157746277 18:50138840-50138862 CAGCCCAGGCTGAGGCAGGATGG - Intronic
1157809101 18:50680554-50680576 CAGGTGATGCTGAAGGGGGATGG - Intronic
1157966156 18:52210679-52210701 CAAGAGAGGATGCAGCAAGAAGG + Intergenic
1158233646 18:55287602-55287624 CAGGAGAGGCCTGAGCAGGCAGG + Intronic
1158513196 18:58109676-58109698 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1158538214 18:58327491-58327513 AGGGAGAGGCTGAGCCAGGAAGG + Intronic
1158561311 18:58516109-58516131 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1158626788 18:59078510-59078532 CAGGACAGGCTGAAACTGGAGGG + Intergenic
1158645836 18:59246303-59246325 CATGTGAGGATGCAGCAGGAAGG - Intergenic
1159874952 18:73800626-73800648 CAGCAGAGGCAGCAGCTGGACGG + Intergenic
1160016107 18:75141853-75141875 CAGGAGAGCCTGCAGCAGGAAGG - Intergenic
1160072872 18:75643583-75643605 GAGCAGAGACTGAAGGAGGAGGG - Intergenic
1160083400 18:75752761-75752783 GAGCAGAGGCTGGAGGAGGAGGG + Intergenic
1160339383 18:78074669-78074691 CAGGCCGGCCTGAAGCAGGAAGG - Intergenic
1160597017 18:79982758-79982780 TAGGAGAGGCTGAAAGAGGCAGG + Intronic
1160781823 19:880811-880833 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
1160787096 19:905723-905745 CAGGGCTGCCTGAAGCAGGAAGG + Intronic
1160816196 19:1036963-1036985 CTCGGGAGGCTGAGGCAGGAAGG - Intronic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1160840816 19:1146394-1146416 CAGGTGTGGCTGCAGCAGAATGG - Intronic
1161106028 19:2444552-2444574 CAGGACAGGGTGAAGCGAGAGGG + Intronic
1161290795 19:3492444-3492466 CTGGAGTGGCTGCAGCAGCACGG - Exonic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161322173 19:3646368-3646390 TAGGGGAGGCTGAGGCAGGATGG + Intronic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161631231 19:5357057-5357079 CAAGAGTGGCTGGGGCAGGACGG + Intergenic
1161717937 19:5887246-5887268 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1161823666 19:6547287-6547309 GATGAGAAGCTGAGGCAGGAAGG + Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162224651 19:9210362-9210384 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1162262946 19:9547462-9547484 GAGGAGAGGCTGAAGAACAAGGG - Intergenic
1162295109 19:9807970-9807992 CTTGGGAGGCTGAAGTAGGATGG + Intergenic
1162355367 19:10180202-10180224 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
1162407106 19:10481486-10481508 CTCGGGAGGCTGAAGCAGAATGG + Intergenic
1162764829 19:12912584-12912606 CAGGAGAGGCTGAGACAACAAGG - Intronic
1162832697 19:13296865-13296887 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1163036857 19:14574802-14574824 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1163050499 19:14679747-14679769 GTGGAAAGGCTGAAGCAGAAGGG - Intronic
1163181972 19:15610512-15610534 CTCGAGAGGCTGAGGCAGGAAGG + Intergenic
1163275549 19:16281750-16281772 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1163509941 19:17728355-17728377 CTGGAGAGGCTGAGGTGGGAGGG - Intronic
1163541962 19:17916863-17916885 GAGGAGAGGCTGCAGAAGGCTGG + Intergenic
1163572656 19:18091365-18091387 CGGGGGCGGGTGAAGCAGGAAGG + Intronic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163668061 19:18612305-18612327 GAGGCGAGGCTGAAGGAGCAAGG + Intronic
1163693682 19:18751414-18751436 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1163703522 19:18799057-18799079 CAGGAGTGGCTGCAGCAAGCGGG + Intergenic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1163795342 19:19334708-19334730 GAGGTGAGGCTGAAGCCCGATGG - Intronic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1164484929 19:28647203-28647225 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
1164534532 19:29075452-29075474 CAGCAGAGGCTGCAGCACCAAGG - Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1164763183 19:30743568-30743590 AAGGAGAGGAGGAAGAAGGAAGG - Intergenic
1165090026 19:33381410-33381432 CAGGAGAAGCTGTCCCAGGAGGG + Exonic
1165361669 19:35340802-35340824 CGGGAGAAGAGGAAGCAGGAGGG + Intronic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165446955 19:35861743-35861765 GAGGGGAGGAAGAAGCAGGAGGG - Intronic
1165450688 19:35880453-35880475 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1165571239 19:36776495-36776517 CTCGGGAGGCTGAAGCAGGAGGG - Exonic
1165735411 19:38172638-38172660 CCAGAGGGGCTGAAGCAGGTGGG + Intronic
1165885930 19:39078312-39078334 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1166116432 19:40658077-40658099 CTCGGGAGGCTGATGCAGGAGGG - Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166197484 19:41216646-41216668 TCGGGGAGGCTGAGGCAGGAGGG + Intergenic
1166292780 19:41873721-41873743 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166678936 19:44756041-44756063 CAGTGGTGGCTAAAGCAGGATGG + Intronic
1166819396 19:45568295-45568317 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1167013979 19:46827612-46827634 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1167073349 19:47233476-47233498 CTGGGGAGGCTGAGGCAGAAAGG - Intergenic
1167081606 19:47279897-47279919 CCAGAGTGGCTGAAGCAAGAGGG + Intergenic
1167109591 19:47451414-47451436 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167610086 19:50503012-50503034 CTGGGGAGGCTGACGCAGAATGG - Intergenic
1167649386 19:50721151-50721173 CCGGAGAGCCTGCAGCTGGAGGG - Intergenic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1168013599 19:53554208-53554230 CGGGAGAGGCCAAAGAAGGAAGG + Intronic
1168062916 19:53903633-53903655 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168223814 19:54980301-54980323 CTGGGGAGGCTGAGGCAGAATGG - Intronic
1168337345 19:55604104-55604126 CTCCGGAGGCTGAAGCAGGAGGG - Intergenic
1168705865 19:58469962-58469984 CAGGAGGGGCTGATGATGGAAGG - Intronic
1168709398 19:58490051-58490073 CTGGGGAGGCTGAAGTGGGAGGG - Intronic
925450749 2:3967468-3967490 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
925615771 2:5743431-5743453 CAGGTGATGCTGATGCAGGTAGG - Intergenic
925856836 2:8137180-8137202 CAGGAGGGTCTGAATCAGGCAGG - Intergenic
926087316 2:10028585-10028607 CAGGAGGGCCTGGAGCATGAGGG - Intergenic
926200074 2:10788546-10788568 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
926289728 2:11518990-11519012 CTTGGGAGGCTGAGGCAGGATGG + Intergenic
926290824 2:11528607-11528629 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
926650476 2:15338765-15338787 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
926838682 2:17053403-17053425 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
926853431 2:17226448-17226470 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
926895148 2:17678666-17678688 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
927091957 2:19719151-19719173 CTGGAGAGGGGGAACCAGGAAGG - Intergenic
927556381 2:24036397-24036419 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
927904127 2:26845235-26845257 GAGGACGTGCTGAAGCAGGAAGG + Intergenic
927957951 2:27221308-27221330 CATGAGTGGCTGCAGCAGCATGG + Exonic
928159583 2:28909764-28909786 CCTGAGAGGCTGGGGCAGGAGGG + Intronic
928436746 2:31259443-31259465 CAGTAGGAGCTGAAGTAGGAGGG - Intronic
928835970 2:35545439-35545461 CAAGAAAGTCTGAGGCAGGAGGG + Intergenic
928868084 2:35942643-35942665 CAAGGGAGGCTGAGGCAGGAAGG - Intergenic
929091494 2:38221950-38221972 CAGGACAGGAGCAAGCAGGATGG + Intergenic
929273618 2:40001464-40001486 CTTGAGAGGCTGAGGCAGAACGG - Intergenic
929623859 2:43386158-43386180 AAGTGGAGGATGAAGCAGGAAGG + Intronic
929754186 2:44750262-44750284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
930025792 2:47028431-47028453 CAGGAGGGGCTGGTGCAGCATGG - Intronic
930235567 2:48885646-48885668 AAGGAGAGGCTGATACAGGAAGG + Intergenic
930321008 2:49854456-49854478 CTCGAGAGGCTGAAGCAGAACGG + Intergenic
931034975 2:58230408-58230430 CTTGAGAGGCTGAGGCGGGAGGG - Intronic
931215459 2:60238426-60238448 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
931420252 2:62120828-62120850 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
931450626 2:62364961-62364983 AGGCTGAGGCTGAAGCAGGAGGG - Intergenic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
931665070 2:64604568-64604590 CAGCAGAGGCTGAAGCGGGGAGG - Intergenic
931704776 2:64938167-64938189 CAGCTAAGGCTGAAGCAGGGGGG - Intergenic
931723103 2:65081800-65081822 CACGGGAGGCTGAGGCAGAATGG - Intronic
931728980 2:65136358-65136380 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
931931897 2:67147147-67147169 CAGGAGAGCATGATCCAGGATGG - Intergenic
932129555 2:69175514-69175536 CTGGGGAGGCTGAGGCTGGAGGG + Intronic
932219446 2:69988830-69988852 CAGAAGAGTCTGGAGTAGGATGG + Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
933000758 2:76919492-76919514 CAGGAGAGGTTTAACCAGAAGGG - Intronic
933141126 2:78793856-78793878 AGTGAGAGGCTGAAGCTGGATGG + Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933332424 2:80910710-80910732 CAGGAGAGGAGGAAGCCAGAAGG - Intergenic
933350652 2:81148193-81148215 CAGGAGAGACTGGAGGAGGCAGG + Intergenic
933481393 2:82861382-82861404 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933665511 2:84961362-84961384 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
933792670 2:85895562-85895584 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933820608 2:86108016-86108038 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
934039477 2:88116018-88116040 CAGGAGAGGCTGGTGCAGGATGG + Intergenic
934183947 2:89654751-89654773 CTTGGGAGGCTGAAGCAAGAGGG - Intergenic
934294237 2:91728916-91728938 CTTGGGAGGCTGAAGCAAGAGGG - Intergenic
934564337 2:95330126-95330148 GAGAAGAGGCAGGAGCAGGAAGG + Intronic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935129875 2:100253648-100253670 CATGAGAGGCTGCAGCTGAAGGG - Intergenic
935298199 2:101669180-101669202 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
935400539 2:102655849-102655871 CATGTGAGGCTGAAACAAGAAGG - Intronic
935659718 2:105455805-105455827 CAGGAGAGGCAAAGGCTGGAGGG - Intergenic
935703413 2:105834776-105834798 CCCGGGAGGCTGAAGCAGGGGGG - Intronic
935987732 2:108690831-108690853 CTGGGGAGGTTGAGGCAGGAGGG - Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936082809 2:109446508-109446530 CAGGGGAGGCTGAGGCTGCAGGG + Intronic
936126560 2:109793535-109793557 CTGGGGAGGTTGAGGCAGGAGGG - Intronic
936218133 2:110577933-110577955 CTGGGGAGGTTGAGGCAGGAGGG + Intergenic
936249427 2:110856271-110856293 CAGGATGGGATGGAGCAGGATGG - Intronic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936376068 2:111942453-111942475 CAGGAAGGGCTGAAGAAAGATGG - Intronic
936398168 2:112145377-112145399 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
936471748 2:112805048-112805070 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
936608380 2:113979245-113979267 CAGGAGAGGAGTAAGCAGAAGGG + Intergenic
936956927 2:118031761-118031783 CAGAAGAGGAGGGAGCAGGAAGG + Intergenic
937157122 2:119728919-119728941 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
937486157 2:122316856-122316878 CAGGAGAGGCAAAAGAAGAAAGG - Intergenic
937541368 2:122958295-122958317 CAGGATAGGATGAAGCAGCTTGG - Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938012227 2:127838063-127838085 CTCGAGAGGCTGAGGCAGGAAGG - Intergenic
938014509 2:127856480-127856502 CTTGGGAGGCTGAGGCAGGATGG + Intronic
938033524 2:128016412-128016434 CAGGAATGGCTGAAGCTTGAGGG + Exonic
938419759 2:131135706-131135728 CTAGAGAGGCTGAGGCAGAATGG - Intronic
938663570 2:133511307-133511329 CAGGGGAGGCTGGGCCAGGAGGG - Intronic
939524568 2:143276688-143276710 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
939581178 2:143947851-143947873 CAGGAGGAGGTGAAGAAGGAAGG + Intronic
939956189 2:148529453-148529475 AAGGAGAGGCTGAAGGTGCACGG - Intergenic
939983347 2:148806596-148806618 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941101233 2:161297836-161297858 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
941278319 2:163518333-163518355 CTTGAAAGACTGAAGCAGGAGGG + Intergenic
941356876 2:164504637-164504659 CAGATGAGGCTGAAGAGGGAAGG - Intronic
941373000 2:164691074-164691096 CAGGAGTGGAGGAAACAGGAGGG - Intronic
941380356 2:164785052-164785074 CATGTGAGGATGAAGCAAGAAGG + Intronic
941404528 2:165071891-165071913 TGTGAGAGGCTGAAGCAGGAGGG - Intergenic
941495467 2:166195938-166195960 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941605815 2:167595124-167595146 CAGGAGAGGATGCAGCAGGCTGG + Intergenic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
941797085 2:169611098-169611120 CTCGGGAGGCTGAGGCAGGAAGG + Intronic
941827605 2:169917312-169917334 CTGGACAGGGTGAAGAAGGAGGG - Intronic
941986821 2:171518629-171518651 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
942228811 2:173840562-173840584 CTGGAGAGGCTGGAGCAAGTTGG - Intergenic
942339794 2:174931898-174931920 CTGGTCAGGCTGAAGCAGAATGG + Intronic
942610624 2:177738682-177738704 CTGGTGAGGCTGCAGCAGGGAGG - Intronic
942842520 2:180379647-180379669 CGCAAGAGGCTGAGGCAGGAGGG + Intergenic
943038835 2:182779499-182779521 CTTGAGAGGCTGAGGCAGGAGGG + Exonic
943101011 2:183486550-183486572 CAGGAGATCCTAAAGCAGAATGG - Intergenic
943340632 2:186676494-186676516 CTGGGGAGGCTGAAGCATGGAGG + Intronic
943649563 2:190442354-190442376 CAGGAGAGACTGAGGCCAGATGG + Intronic
943755760 2:191555304-191555326 TGGGAGAGGCTGAACTAGGATGG + Intergenic
944550673 2:200841828-200841850 CTCCAGAGGCTGAGGCAGGAAGG + Intergenic
944819326 2:203414003-203414025 CTGAAGAGGATGAGGCAGGAAGG - Intronic
944875018 2:203954479-203954501 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
945138078 2:206651595-206651617 GAGTAGAGGATGAAGAAGGAAGG - Intergenic
945302278 2:208225675-208225697 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
946009574 2:216554079-216554101 CAGGAGAGCCTGGAGCATTAGGG - Intronic
946382946 2:219361395-219361417 CCAGAGAGGCTGAAGCTGAAAGG - Intergenic
946731861 2:222717514-222717536 AGGGAGAGGATGAGGCAGGAAGG + Intergenic
947246252 2:228051831-228051853 TAGGTGAGGATGAAGCAAGAAGG - Intronic
947507193 2:230716892-230716914 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
947567670 2:231204959-231204981 CAGGAGGGTCCCAAGCAGGAGGG + Intronic
947715750 2:232338135-232338157 CAGGAGAGCCCCAAACAGGAAGG + Intronic
947747395 2:232515800-232515822 CAAGAGAGGCGGAGGCTGGAGGG - Intergenic
947792458 2:232876098-232876120 CAGGAGCGGCTGGACCAGGGCGG + Exonic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948371049 2:237489167-237489189 CAGGTGAGGCTGTAGGAGGATGG - Intronic
948516870 2:238509635-238509657 CAGGAGAGGCTGCAGCAGCCAGG - Intergenic
948841124 2:240649562-240649584 CAGGACAGGCTGAAGAGGGGCGG + Intergenic
949022502 2:241749413-241749435 CCAGAGACGCTGCAGCAGGAGGG - Intronic
1169007689 20:2222401-2222423 CACAGGAGGCTGAGGCAGGAAGG - Intergenic
1169198338 20:3695085-3695107 CAGGAGAGTGGGGAGCAGGAGGG - Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169244779 20:4016599-4016621 GCTGAGAGGCTGCAGCAGGAGGG - Intergenic
1169268693 20:4182879-4182901 CAGGTGAGGAAGAAGCAGGGTGG - Intronic
1169354052 20:4893169-4893191 CTTGAGAGGCTGAAGTGGGAGGG - Intronic
1169358122 20:4924748-4924770 CAGGAAAGGCTGCACCAAGAAGG - Intronic
1169477745 20:5947941-5947963 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1170105829 20:12753716-12753738 CAGGAAACACTGAAGCATGAGGG - Intergenic
1170451583 20:16489249-16489271 TAGGCGAGGCTGAAGGGGGAGGG + Intronic
1170562225 20:17568307-17568329 CAGGAGAGGCTGGAGCAAGCAGG + Intronic
1170566821 20:17612286-17612308 TAGAGGAGGCTGAAGCAGAAAGG - Intergenic
1170632377 20:18076570-18076592 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1170636459 20:18109613-18109635 CTTGAGAGGCTGAAGTGGGAGGG - Intergenic
1170837605 20:19897954-19897976 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1171209150 20:23303613-23303635 AAGGAGAGGGTGAAGGATGAGGG - Intergenic
1172033978 20:31999183-31999205 CAAGAGAGGCTGAACCAGGGAGG - Exonic
1172084030 20:32364644-32364666 CAGCTGAGACTGAGGCAGGAGGG - Intronic
1172084605 20:32371027-32371049 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1172095259 20:32457281-32457303 CGGCAGAGGCTGAAGCTGCACGG + Intronic
1172123424 20:32611541-32611563 CAGGAGAGGGGGCAGCAGCATGG - Intergenic
1172234740 20:33363788-33363810 CTCCGGAGGCTGAAGCAGGAGGG + Intronic
1172253502 20:33496809-33496831 CAGGATAGGGTGAAAAAGGATGG - Intronic
1172331834 20:34080782-34080804 CAGGAGAGGCTGGAGTAAGCAGG - Intronic
1172617389 20:36298292-36298314 CACTAGATGCTGAAGCAGGCAGG + Intergenic
1172642375 20:36448240-36448262 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1172655484 20:36534285-36534307 CATGGGAGGCTGAGGCAGAAGGG + Intergenic
1173199496 20:40944162-40944184 CAGGAGAGGCGGAGGGAGGGAGG - Intergenic
1173248321 20:41351143-41351165 CTGAGGAGGCTGAGGCAGGAGGG + Intronic
1173492839 20:43497281-43497303 CTTGGGAGGCTGGAGCAGGAGGG + Intergenic
1173541687 20:43857365-43857387 AAGGGAAGGCTGAAGCAGGGAGG + Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173901969 20:46596943-46596965 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1173911733 20:46675687-46675709 CTGGGGAGGCTGAGGCGGGAAGG - Intronic
1173911887 20:46676692-46676714 CTGGGGAGGCTGAGGCGGGAAGG - Intronic
1173937733 20:46881718-46881740 CAGGAGAGACTGCAGCTGGTAGG + Intergenic
1174000020 20:47367760-47367782 CTCTAGAGGCTGAGGCAGGAAGG + Intergenic
1174000069 20:47368108-47368130 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
1174012178 20:47458787-47458809 CTCAGGAGGCTGAAGCAGGATGG + Intergenic
1174022594 20:47542852-47542874 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174163225 20:48566273-48566295 CACGGGGGGCTGAAGCAGGTGGG + Intergenic
1174244240 20:49164406-49164428 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1174416386 20:50369896-50369918 CAGGAGAAGCTAGAGCAGCACGG - Intergenic
1174488787 20:50877614-50877636 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174589751 20:51635627-51635649 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1174710299 20:52697437-52697459 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1174828214 20:53788447-53788469 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1175119765 20:56708693-56708715 CATGGGAGGCTGAGGCAGGAGGG + Intergenic
1175220676 20:57414761-57414783 GTGGGGAGACTGAAGCAGGAGGG - Intergenic
1175398980 20:58689104-58689126 CAGGTCATTCTGAAGCAGGAAGG + Intronic
1175755806 20:61528966-61528988 CAACAGAGGCCAAAGCAGGAAGG + Intronic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1177232531 21:18341167-18341189 CCGGAGAGGCTGAGGCAGGAGGG - Intronic
1177489472 21:21803885-21803907 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1177669740 21:24209257-24209279 CATGTGAGGATGTAGCAGGAAGG + Intergenic
1178011570 21:28292324-28292346 CTGAAGAGACTGAAGCAGCAGGG - Intergenic
1178281664 21:31288434-31288456 CAGGAGAGGATGTATCAGGAAGG - Intronic
1178719475 21:34995546-34995568 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
1178762857 21:35420825-35420847 CAGTAGTGGCTGGAGCAGGCGGG + Intronic
1178831217 21:36058391-36058413 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1178855042 21:36243778-36243800 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1178950808 21:36983941-36983963 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1178978231 21:37239057-37239079 CCTGAGCGGCTGCAGCAGGAAGG - Intronic
1179126399 21:38595036-38595058 CAGGAGAGCCCGAGGCAAGAGGG + Intronic
1179317799 21:40260375-40260397 CAGCTGTGGCTGAGGCAGGAAGG - Intronic
1179337922 21:40475113-40475135 CACGACAGTCTGAAGGAGGAGGG - Intronic
1179934075 21:44591409-44591431 GAGCAGAGGCTGTAGCAGGCAGG + Exonic
1179939326 21:44628006-44628028 GAGGAGAAGCTGTAGCAGGCCGG - Exonic
1179940810 21:44638129-44638151 GAGCAGAGGCTGTAGCAGGCAGG - Exonic
1179969616 21:44827470-44827492 CAGGAAAGGCTGGAGCATGTGGG + Intergenic
1180024160 21:45149133-45149155 CAGCAGAGGCTGATGCATCATGG - Intronic
1180046343 21:45307520-45307542 CAGGAGAGTCTGGCCCAGGAGGG + Intergenic
1180216944 21:46330223-46330245 CTAGGGAGGCTGAGGCAGGAGGG - Intronic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181104153 22:20562926-20562948 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181528855 22:23504703-23504725 GAGGAGAGGCAGAAGCTGGGAGG + Intergenic
1181632702 22:24159618-24159640 CACGTGAGGCTCAAGCAAGAGGG - Intronic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1182029974 22:27151014-27151036 CAGGAGAAACTGGAGCAGGTGGG + Intergenic
1182070922 22:27463058-27463080 CAGCAGAGGCTGAGGCAGGGAGG + Intergenic
1182098263 22:27640195-27640217 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1182109025 22:27709908-27709930 AAGGAGACGGTGAACCAGGAAGG - Intergenic
1182139276 22:27938831-27938853 CTGAAGAGGTTGAGGCAGGAGGG + Intergenic
1182207444 22:28643212-28643234 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1182387162 22:29954187-29954209 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
1182401936 22:30085036-30085058 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1182474218 22:30567519-30567541 TTGGGGAGGCTGAGGCAGGAGGG - Intronic
1182580599 22:31307706-31307728 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1182609886 22:31538546-31538568 CAGTAGAGGCTGCAGCAGTCAGG - Intronic
1182655761 22:31888655-31888677 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1182681793 22:32085227-32085249 CTCAGGAGGCTGAAGCAGGAAGG - Intronic
1182718012 22:32375645-32375667 CAGGAGAGGGGGTATCAGGAGGG - Intronic
1183200535 22:36382976-36382998 TCTGAGAGGCTGAGGCAGGAGGG + Intronic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183654606 22:39177318-39177340 CAGGAGGGGCTGCAGTGGGATGG + Intergenic
1183758769 22:39796378-39796400 CACGGGAGGCTGAGGCAGGAGGG - Intronic
1183759569 22:39803917-39803939 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1183973333 22:41495132-41495154 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1184041713 22:41947875-41947897 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1184112596 22:42404055-42404077 CCGGAGGGGCTGGGGCAGGAGGG - Intronic
1184125873 22:42486651-42486673 CTTGGGAGGCTGAAGCAGGATGG + Intergenic
1184208984 22:43024177-43024199 CCCAGGAGGCTGAAGCAGGAGGG - Intergenic
1184254288 22:43278333-43278355 AAGGAGTGGCTGAAGAAGGCAGG + Intronic
1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG + Intronic
1184343033 22:43896467-43896489 CAGCAGAGGCACAAGCATGAGGG + Intergenic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184509327 22:44923901-44923923 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1184513555 22:44946677-44946699 CAGGAGAGTCTTCTGCAGGAAGG - Intronic
1184517935 22:44974304-44974326 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1184601787 22:45548291-45548313 CATGGGAGGCTGAGGCAGGAGGG - Intronic
1184608487 22:45587697-45587719 CTGGAGTGGCTGAAGCAGAGCGG - Intronic
1184656837 22:45946185-45946207 CAGGAGAGGCTGGAGGGTGAGGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185005951 22:48277094-48277116 CAGGAGTGGCTGCAGCAGCCCGG - Intergenic
1185014117 22:48333550-48333572 CGTGAGAGGCTGCAGCAGGCGGG + Intergenic
1185096733 22:48811017-48811039 CTCTAGAGGCTGAGGCAGGAGGG + Intronic
1185127074 22:49017269-49017291 CAGAAGGGGATGGAGCAGGAAGG + Intergenic
1185176876 22:49332878-49332900 GAGAAGAGGCTGCAGCAGGTGGG + Intergenic
1185265160 22:49898106-49898128 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185301232 22:50082142-50082164 CGGGACCAGCTGAAGCAGGAGGG + Intronic
949423601 3:3891902-3891924 GAGGATGTGCTGAAGCAGGATGG - Intronic
949477773 3:4465365-4465387 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
949485116 3:4530671-4530693 CACAGGAGGCTGAGGCAGGAGGG + Intronic
949541882 3:5038919-5038941 CTTGTGAGGCTGAGGCAGGAAGG + Intergenic
949647064 3:6107622-6107644 CAGGAGAGGCCAAAGAAGCAGGG + Intergenic
949706726 3:6826934-6826956 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
949803966 3:7934332-7934354 GAGGACAAGCTGAAGCAGGGCGG + Intergenic
949935016 3:9109857-9109879 CAGGAGAGGGAGGAGCAGGTAGG + Intronic
950108304 3:10402293-10402315 AAGGAGAGGCAGAGGCAGGTTGG - Exonic
950117671 3:10461956-10461978 CAGGAGAGTGGGAAGAAGGAAGG - Intronic
950150573 3:10683902-10683924 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950350513 3:12346740-12346762 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
950538716 3:13597172-13597194 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
950773205 3:15328630-15328652 CTGGGGAGGATGATGCAGGAGGG + Intronic
950891425 3:16408152-16408174 CATGAGGGCCTGAGGCAGGAGGG - Intronic
951191316 3:19774937-19774959 AAGGTGAGGATGAGGCAGGAAGG - Intergenic
951514196 3:23540169-23540191 CTCGGGAGGCTGAAGCAGGAGGG - Intronic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
951580799 3:24160410-24160432 CAAGAGAGGGTGAACCTGGAGGG + Intronic
952757227 3:36881342-36881364 CTGGGGAGGCTGAGGCAGAATGG + Intronic
953628818 3:44593737-44593759 GAGTAGAGGATGAGGCAGGAAGG + Intronic
953702632 3:45208520-45208542 CAGATGAGGCTGAGGCAGCAAGG + Intergenic
953861772 3:46550497-46550519 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
953970096 3:47340511-47340533 CAAGAGAGGCTGCTCCAGGAAGG + Intronic
954069601 3:48133329-48133351 CGTGGGAGGCTGAGGCAGGAGGG - Intergenic
954311401 3:49771009-49771031 CTAGGGAGGCTGAGGCAGGAGGG + Intronic
954319218 3:49819817-49819839 CATGGGAGGATGAGGCAGGAAGG + Intergenic
954776815 3:53026838-53026860 CTGGAGAGGCTGGAGTAAGATGG + Intronic
955171281 3:56567795-56567817 CTGGGGAGGCTGAGGCAGAATGG - Intronic
955397461 3:58567203-58567225 CAGCAGAGGCTGAACCAGGTGGG - Exonic
955400108 3:58585484-58585506 CAGGCGGGGCTTAAGCGGGAAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956089373 3:65649272-65649294 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
956162709 3:66371852-66371874 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
956176302 3:66476358-66476380 GAGGAGAGGCTAAGGGAGGAAGG - Intronic
956665058 3:71634179-71634201 CTTGGGAGGCTGAGGCAGGACGG - Intergenic
956980801 3:74634976-74634998 CTGGAGAGGCTGAAACTGGGAGG - Intergenic
957060839 3:75480148-75480170 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
958459774 3:94379953-94379975 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
958521092 3:95186523-95186545 CTGCAGAGGCTAAGGCAGGAGGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959968188 3:112379923-112379945 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
960440217 3:117677753-117677775 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
960653015 3:119972541-119972563 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
960673074 3:120170547-120170569 GAGGAGAGGCTGGTGGAGGAGGG - Intronic
961080621 3:124024297-124024319 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
961292544 3:125859257-125859279 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
961567400 3:127773516-127773538 CAGGAGAGGCCTAGGCAGGTAGG + Intronic
961823467 3:129586884-129586906 CAGCAGAGGCAGAAGCATCAAGG - Intronic
961894639 3:130157120-130157142 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
961902936 3:130231990-130232012 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
962226945 3:133620928-133620950 CATGAGAGTCAGAAGCAGGCAGG - Intronic
962346569 3:134623417-134623439 TAGAGAAGGCTGAAGCAGGAGGG - Intronic
962391277 3:134974876-134974898 CAGGAGCAGCTCAAGCAGGAAGG - Intronic
962522310 3:136208824-136208846 CTTGAGAGGCTGAGGCAGGGAGG - Intergenic
962713494 3:138107388-138107410 CAGGAGATGATGCAGCAGGAAGG + Intronic
962947131 3:140182456-140182478 CAGGACAGACTGAAGAAGGCTGG - Intronic
963042588 3:141080542-141080564 GTGGAGAGGCTGCAGCATGATGG - Intronic
963596728 3:147337002-147337024 CAGGAGAAGCTGCAGCTGCATGG + Intergenic
964019361 3:151989629-151989651 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
964049672 3:152375080-152375102 CTTGGGAGGCTGAAGAAGGAAGG - Intronic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
964570081 3:158101498-158101520 CAGGAGAGGCTTAAAAAGGAAGG + Intronic
964840297 3:160986262-160986284 CAGGAGATGCTGGAGAATGAAGG + Intronic
965122039 3:164572538-164572560 CAGCAGAGGCTGAATTAGTAGGG - Intergenic
965595668 3:170408570-170408592 CTCGAGAGGCTGAGGCAAGAGGG - Intergenic
965667565 3:171111305-171111327 CATGAGAGGCTGAGGTGGGAGGG + Intronic
965953869 3:174344512-174344534 CAGGGGAGGCTGGAGAGGGATGG - Intergenic
965977037 3:174638559-174638581 TAGGAGATGTTGAAGAAGGAGGG + Intronic
966002003 3:174960927-174960949 CTTAAGAGGCTGAAGCAGGAGGG + Intronic
966063997 3:175794975-175794997 CATGTGAGGATGCAGCAGGAAGG - Intronic
966698076 3:182813833-182813855 CTCGGGAGGCTGACGCAGGAGGG - Intronic
966740790 3:183231560-183231582 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
966871005 3:184290665-184290687 CAAGTGTGTCTGAAGCAGGAGGG + Exonic
966937843 3:184725577-184725599 CAGGGGAAGCTGCATCAGGACGG - Intergenic
967810380 3:193754971-193754993 TAGGTGAGGCTGAAGCAGCTGGG - Intergenic
968030057 3:195475956-195475978 CCTGGGAGGCTGAAGCGGGAGGG - Intergenic
968148515 3:196319243-196319265 CAGGAGAGGCTGAAAGGGCAGGG + Intronic
968189843 3:196659870-196659892 CAGGAGAGGGTAAGGCTGGAGGG - Exonic
968365794 3:198183859-198183881 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
968404022 4:323858-323880 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
968783505 4:2601010-2601032 CACAGGAGGCTGAGGCAGGAGGG + Intronic
968814874 4:2817149-2817171 CAGGAGTGGCTGAATCAGGAAGG + Intronic
968837837 4:2978700-2978722 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
968843318 4:3024368-3024390 CGTGGGAGGCTGAGGCAGGAGGG - Intronic
968940012 4:3632867-3632889 CAGGAGTGGAAGACGCAGGAAGG + Intergenic
968969857 4:3788160-3788182 CAGGAGGGGCAGGAGCTGGAGGG - Intergenic
969034436 4:4241654-4241676 CATGAGAGGCTGTAGAGGGAAGG + Intronic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969190023 4:5510664-5510686 CTGGTGAGGCTGCAGCAGAAAGG + Intergenic
969206663 4:5652277-5652299 GAGGAGAGGCTGCGTCAGGATGG + Intronic
969444492 4:7236455-7236477 CAGGAGGTGCTGGGGCAGGAGGG + Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969748134 4:9089944-9089966 CTCAAGAGGCTGAAGCAGGAGGG + Intergenic
969809156 4:9634487-9634509 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
969843073 4:9897780-9897802 CACGGGAGGCTGAGGCAGGAGGG + Intronic
969911141 4:10447540-10447562 GAGGAGAGGCTGGAGCAGAAAGG + Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970566103 4:17334088-17334110 AAGCAGAGTCTGAGGCAGGATGG - Intergenic
971260705 4:25054342-25054364 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
971298016 4:25417230-25417252 TATGAGAGGCTGAGGCAGGAGGG - Intronic
971312121 4:25534293-25534315 CTCGGGAGGCTGAAGCAGGGAGG + Intergenic
971434524 4:26606089-26606111 CTGGGGAGGCTGAAGCCAGAGGG - Intronic
971447547 4:26767060-26767082 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
971594363 4:28509851-28509873 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
972258897 4:37388289-37388311 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
972389207 4:38597282-38597304 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
972392054 4:38623044-38623066 CAGGAGAGGATGAGGAGGGACGG + Intergenic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972506598 4:39725748-39725770 CTCAGGAGGCTGAAGCAGGAGGG - Intronic
972671651 4:41217751-41217773 CTGGGGAGGCTGAGGCAAGAGGG + Intergenic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
973236162 4:47908314-47908336 CTTGGGAGGCTAAAGCAGGAGGG + Intronic
973310311 4:48702654-48702676 TCGTAGAGGCTGAAGCAGAATGG + Intronic
973647125 4:52961012-52961034 CAGGAGAGGCTGAGGAGGGTTGG + Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973991919 4:56417676-56417698 CTTGTGAGGCTGAGGCAGGAAGG + Intronic
974083372 4:57235057-57235079 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974423707 4:61712283-61712305 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
974748261 4:66103569-66103591 CAGGAGAGGCTGGGGCAAAATGG + Intergenic
974945807 4:68527611-68527633 CAGGAAAGGGTGAAACAAGAAGG + Intergenic
974955675 4:68638512-68638534 CAGGAAAGGGTGAAACAAGAAGG + Intronic
975572262 4:75829960-75829982 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
975713247 4:77181262-77181284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
975795591 4:78003370-78003392 CTTCAGAGGCTGAGGCAGGAGGG - Intergenic
975989459 4:80242393-80242415 CTTGAGAGGCTGAAGTGGGAGGG - Intergenic
976172776 4:82321444-82321466 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
976328349 4:83798793-83798815 TAGTGGTGGCTGAAGCAGGAGGG - Intergenic
976448191 4:85156098-85156120 CAGGAAAGGAGGAAGAAGGAAGG + Intergenic
977780153 4:100971469-100971491 CAGGAGAGGAGGCAGCAAGAAGG - Intergenic
977818376 4:101442712-101442734 CTCGGGAGGCTGAGGCAGGAGGG - Intronic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978030481 4:103936334-103936356 CAGGAGAGGGTGGAGCAAGATGG + Intergenic
978084281 4:104631575-104631597 CATGAGAGGAGTAAGCAGGAAGG - Intergenic
978421289 4:108535876-108535898 CAAGAGAGGGTGGAGAAGGAAGG - Intergenic
978541134 4:109817171-109817193 CTTGAGAGCCTGAATCAGGATGG + Intronic
978558473 4:110006235-110006257 CTCAAGAGACTGAAGCAGGAGGG + Intronic
979111253 4:116761085-116761107 CAGGAGAGGTGGAAGGAGTAGGG - Intergenic
979254829 4:118599013-118599035 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980585584 4:134810605-134810627 TTGGGGAGCCTGAAGCAGGAGGG - Intergenic
980721376 4:136700025-136700047 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
981302499 4:143204495-143204517 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
981520208 4:145652975-145652997 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
981641876 4:146953673-146953695 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982235008 4:153243924-153243946 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
982561261 4:156930758-156930780 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
982665375 4:158254513-158254535 CTGGGGCGGCTGAAGTAGGAGGG + Exonic
982943569 4:161589558-161589580 CTTGGGTGGCTGAAGCAGGAGGG - Intronic
982979336 4:162112348-162112370 CTGGGGAGGCTGAGACAGGAGGG - Intronic
983091745 4:163511715-163511737 CATGGGAGGCTGAGGCAGGATGG + Intronic
983531450 4:168813700-168813722 CTGGTGAGGCTGAGGCAGGAGGG - Intronic
983682719 4:170372105-170372127 CTTGAGAGGCTGAGGCAGGAGGG - Intergenic
984251951 4:177346272-177346294 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
984553886 4:181191663-181191685 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
984561932 4:181281088-181281110 CAGAAGGGGTGGAAGCAGGAAGG + Intergenic
984591150 4:181619061-181619083 CAGCAGAGATTGAAGCAGGAAGG + Intergenic
984792469 4:183627274-183627296 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
985093816 4:186392041-186392063 CAGAAGAGGCTGCAGAAGAAAGG + Intergenic
985252325 4:188036374-188036396 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985616802 5:927472-927494 CAGGAGGGGCTGGAACAGCAGGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
985976680 5:3424443-3424465 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986226748 5:5823106-5823128 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
986392176 5:7297431-7297453 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
986429454 5:7666780-7666802 TGGGAGAGGATGGAGCAGGAAGG - Intronic
986714405 5:10512415-10512437 TAGGAGGGGCCAAAGCAGGAGGG + Intronic
986848857 5:11786536-11786558 CAGGAAAGGCTGAAGCAAGATGG + Intronic
987071294 5:14339127-14339149 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
987224993 5:15830959-15830981 CTGGAGAGTCTCAAGCAGCAAGG + Intronic
987372614 5:17207262-17207284 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988463071 5:31459283-31459305 TATAGGAGGCTGAAGCAGGAGGG + Intronic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
988558255 5:32257339-32257361 CAAGAGAGGGTGAAGCAGGTGGG + Intronic
988569459 5:32349991-32350013 CTCGGGAGGCTGAAGCAGAATGG + Intergenic
988582103 5:32477374-32477396 CTGGGGAGGCTGAGGCAGGACGG - Intergenic
988606920 5:32686518-32686540 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
989074952 5:37554812-37554834 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
989458188 5:41666552-41666574 CAGGAGAGTTTTAAGTAGGAGGG + Intergenic
989479056 5:41907077-41907099 CAGGAGATGGTGAAGGCGGAGGG + Intronic
990232880 5:53734093-53734115 CAGGAGAGGCTGCAGCAGGTTGG + Intergenic
990303739 5:54474824-54474846 CAGGGGAGGTTGAAGAAAGATGG - Intergenic
990361940 5:55029649-55029671 TTTGAGAGGCTGAAGCAGGAGGG - Intronic
990577046 5:57133429-57133451 CTGGAGAGGCTGAGGTGGGACGG - Intergenic
991250266 5:64552817-64552839 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
991359357 5:65803378-65803400 CAGTAGGGGCTGAGGCAGCAAGG + Intronic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
991956258 5:71998398-71998420 CAGCAGAGGCTGGTGGAGGAAGG + Intergenic
992086797 5:73284695-73284717 AAGGAAAGGCTGCAACAGGAAGG + Intergenic
992103572 5:73431075-73431097 CTCGGGAGGCTGAGGCAGGATGG + Intergenic
992754230 5:79889171-79889193 AAGGAGAAGCTGTAGCAGAATGG + Intergenic
993691578 5:91007436-91007458 CACAAGAGGCAGTAGCAGGATGG - Intronic
993716319 5:91278806-91278828 CTGGAGAGGCTGAGGCGGAAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994292807 5:98050245-98050267 AAGGAGGGGGTGAAGCAAGATGG + Intergenic
994362464 5:98868217-98868239 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
994427532 5:99610630-99610652 CAAGTGAGTCTGAAGGAGGAGGG + Intergenic
994450216 5:99931442-99931464 CTCGGGAGGCTGAAGCAGAATGG - Intergenic
994595050 5:101821531-101821553 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
994776268 5:104038715-104038737 CAGGACAACTTGAAGCAGGAAGG - Intergenic
995100337 5:108292981-108293003 CTGGGGAGGCTGAGGCAGAATGG + Intronic
995231044 5:109763907-109763929 CTAGGGAGGCTGAGGCAGGAGGG - Intronic
995496397 5:112748887-112748909 CTCTAGAGGCTGAAGCAGGAGGG + Intronic
995506548 5:112866452-112866474 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
995519346 5:112986893-112986915 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG + Intergenic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
997584177 5:135034782-135034804 GAGAAGAGGCTGGAGAAGGAGGG - Intronic
997596222 5:135109025-135109047 GAGGATAGGCTGGAGAAGGAAGG + Intronic
997628413 5:135347492-135347514 CAGGACAGGTAGAGGCAGGAGGG - Intronic
997704429 5:135933749-135933771 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
998172601 5:139881326-139881348 CAGGAGAGGCAGAGGCAGCTGGG - Intronic
998459584 5:142299818-142299840 CAAGAGCTTCTGAAGCAGGAAGG + Intergenic
999053475 5:148549072-148549094 CAGGAGAGGCTGGACCACGCTGG - Intronic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999324432 5:150634711-150634733 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
999721133 5:154400028-154400050 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1000072466 5:157753596-157753618 CAGGTGATTCTGATGCAGGATGG - Intronic
1000080357 5:157839495-157839517 CTTGAGAGGCTGAGGCAGAATGG + Intronic
1000464136 5:161554288-161554310 CAGGATAGGTTGAAGCAGAGGGG + Intronic
1001391759 5:171385313-171385335 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1001971249 5:175956614-175956636 CAGCAGCGGGTGAAGGAGGAGGG - Intronic
1002246193 5:177887163-177887185 CAGCAGCGGGTGAAGGAGGAGGG + Intergenic
1002558872 5:180066727-180066749 CTAGGGAGGCTGAGGCAGGAAGG + Intronic
1002618038 5:180467598-180467620 CCAGAAAGTCTGAAGCAGGAAGG + Intergenic
1002630519 5:180572655-180572677 GCGGGGAGGCTGAGGCAGGAGGG - Intronic
1002725019 5:181289079-181289101 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1002847227 6:957670-957692 CAGGATAGGCTGAAGGGGGCAGG - Intergenic
1002888260 6:1313744-1313766 CGGGAGAGGTGCAAGCAGGAGGG - Exonic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003553616 6:7120929-7120951 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1003744830 6:8988826-8988848 CTTGGGAGGCTGAAGTAGGAAGG - Intergenic
1004226675 6:13791145-13791167 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004293765 6:14391722-14391744 CAGCAAAGACTGAAGCAGGTGGG + Intergenic
1004473279 6:15947868-15947890 CAGGAGAGGCACAGGAAGGAGGG + Intergenic
1004690882 6:17991038-17991060 CTTGGGAGGCTGAAGCAGGGGGG + Intergenic
1004707524 6:18138372-18138394 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004957701 6:20748400-20748422 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1005027568 6:21478111-21478133 GAGGGGAGGCTGAAGAAGGATGG - Intergenic
1005055635 6:21726374-21726396 CTAGGGAGGCTGAGGCAGGAGGG - Intergenic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1005797931 6:29387244-29387266 CTGGATAGGCTGATGCATGAAGG + Intronic
1005991296 6:30904248-30904270 CTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1006111241 6:31746925-31746947 CTCGGGAGGCTGAAGCAGAATGG - Intronic
1006273713 6:32984185-32984207 TAGGTGATGCTGAAGCAGCAAGG + Intergenic
1006676141 6:35765010-35765032 CACGGGAGGTTGAGGCAGGAGGG + Intergenic
1006690691 6:35882422-35882444 CTTGGGAGGCTGAAGCAGCAGGG - Intronic
1006789698 6:36691838-36691860 CAGAAATGGCAGAAGCAGGATGG - Intergenic
1006911105 6:37564166-37564188 CAGGAGATGCTGAAGCCCCAGGG - Intergenic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007341088 6:41191991-41192013 TAGGGGAAGCTGAAGCAGAACGG + Exonic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007798503 6:44371189-44371211 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1008243388 6:49141448-49141470 CTCGTGAGGCTGAAGCAGGAGGG - Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009515384 6:64609639-64609661 TTTGGGAGGCTGAAGCAGGACGG + Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1009911241 6:69930708-69930730 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1010506129 6:76661757-76661779 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1011010391 6:82696799-82696821 CATGGGAGGCTGAGGCAGGCGGG - Intergenic
1011041721 6:83036839-83036861 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1011375770 6:86685013-86685035 CATGAGAGGATGCAGCAAGAAGG + Intergenic
1011441599 6:87392794-87392816 CAGGAGAGGCTGCAACAGGCTGG + Exonic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012590907 6:100979418-100979440 CAGGAGAGGCCACAGCATGATGG - Intergenic
1012954343 6:105552866-105552888 TATGAGAGGCTGAAGATGGAAGG + Intergenic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1013085482 6:106853393-106853415 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1013136007 6:107283216-107283238 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1014048370 6:116921713-116921735 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1014102243 6:117524307-117524329 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1014136455 6:117895421-117895443 CAGAAGAGTTTTAAGCAGGAGGG + Intergenic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1014235332 6:118948041-118948063 CTTGGGAGGCTGAAACAGGAGGG - Intergenic
1014747865 6:125221005-125221027 GTGGAGAGGCCAAAGCAGGAAGG - Intronic
1015410334 6:132886721-132886743 CAAGAGATTCTGAAGCAGCATGG + Intergenic
1015829088 6:137348203-137348225 TTTGAGAGGCTGAAGCAGGTGGG + Intergenic
1015912173 6:138179915-138179937 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016318764 6:142819124-142819146 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1016527381 6:145017458-145017480 CAGGAGAGGCTGAAGCAGTGTGG - Intergenic
1016587542 6:145707006-145707028 CATGTGAGGCTGCAGCAAGAAGG + Intronic
1016988953 6:149916367-149916389 GAGGAGAGGCTGAGGAAGAAGGG - Intergenic
1016994041 6:149948299-149948321 GAGGAGAGGCTCAAGAAGAAGGG + Intronic
1017056507 6:150441448-150441470 CAGCAGAGGTGGAGGCAGGAAGG - Intergenic
1017132191 6:151117080-151117102 CACAGGAGGCTGAGGCAGGAGGG + Intergenic
1017251562 6:152285570-152285592 CTGGAGTGGCTGAAGAAGGCTGG - Intronic
1017495514 6:154979725-154979747 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1017543690 6:155428542-155428564 CAAGAGAGGGTGATCCAGGAAGG - Intronic
1017885598 6:158597087-158597109 CATGACAGGCTCAGGCAGGAAGG - Intronic
1017962124 6:159232351-159232373 CAGGAGAGGCCGAAGCCGAGGGG - Exonic
1018131900 6:160739651-160739673 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1018641982 6:165912456-165912478 CAGAATGGGCTGAAGCAAGAAGG - Intronic
1018870441 6:167778514-167778536 CAGAAGAGGCTGGAGCAGGCAGG - Intergenic
1018960082 6:168441598-168441620 CCGGCGAGGCTGGAGCAGGTAGG + Intronic
1019302048 7:310435-310457 CTCGGGAGGCTGAGGCAGGAGGG - Intergenic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019500150 7:1360651-1360673 GTGGGGAGGCTGCAGCAGGAAGG + Intergenic
1019644669 7:2122672-2122694 CAGGTGAGACTCAGGCAGGAAGG + Intronic
1019680566 7:2346336-2346358 CTGGGGAGGCCGAAACAGGAGGG + Intronic
1019914952 7:4126984-4127006 CAGGAGAAGCTGAAGAGAGAAGG - Intronic
1019940553 7:4285883-4285905 CAGCAGTGGCAGCAGCAGGAAGG - Intergenic
1020031682 7:4937750-4937772 CTCGAGAGGCTGAGGCAGGGTGG - Intronic
1020132196 7:5565034-5565056 CTGGAGAGGCTGAGGCCAGAGGG + Intergenic
1020324871 7:6966698-6966720 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1020416782 7:7955445-7955467 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020537504 7:9419520-9419542 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1020681189 7:11238827-11238849 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1022121632 7:27314199-27314221 CAGGAAAGGTTCAAACAGGAAGG - Intergenic
1022136977 7:27458070-27458092 CAGGAGTGGCGGCTGCAGGACGG + Intergenic
1022214386 7:28243777-28243799 CAGGTGAGGCCATAGCAGGAAGG + Intergenic
1022241406 7:28516104-28516126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1022304526 7:29134192-29134214 CTGCAGAGGCTGAAGAATGAAGG - Intronic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022711555 7:32855512-32855534 AAGCAAAGGCTGAAGCAGGGAGG - Intergenic
1022728103 7:32998745-32998767 CCGGGGAGGGTGAAGCAGGCAGG + Intronic
1022901235 7:34812436-34812458 TAGGAGATGCTGAAGTGGGATGG + Intronic
1023171461 7:37393829-37393851 AAGGAGAGGCTGAACTAGAAGGG + Intronic
1023250375 7:38253888-38253910 CTCGAGAGGCTGAGGCAGGAGGG + Intergenic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023254719 7:38301735-38301757 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1023389735 7:39698112-39698134 CATGTGAGGATGCAGCAGGAAGG - Intronic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1023612232 7:41982592-41982614 CTTGTGAGGCTGAGGCAGGAGGG + Intronic
1023750519 7:43367950-43367972 CTGGAGAGGTGGAAGCAGAAGGG - Intronic
1023764945 7:43501721-43501743 CTAGGGAGGCTGAAGCAGGAGGG + Intronic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023849592 7:44142798-44142820 CTCCAGAGGCTGAGGCAGGAAGG - Intergenic
1023943464 7:44785151-44785173 GAGGTGAGGATGAAGCAGGAGGG - Intergenic
1024069920 7:45776692-45776714 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1024263497 7:47589106-47589128 CTTGGGAGGCTGAAGCAGGTGGG + Intergenic
1024344183 7:48296290-48296312 CATAGGAGGCTGAGGCAGGAGGG + Intronic
1024766260 7:52664475-52664497 CTGGAGTGGCTGGAGCAGGAGGG - Intergenic
1024977518 7:55127428-55127450 AAGGAGAGGATGAAGGAGTAAGG - Intronic
1025045552 7:55689274-55689296 CCGGAGAGGGTGAAGCAGGCAGG - Intergenic
1025187379 7:56871520-56871542 GAGGAGAGGCTGGGGCAGGAGGG + Intergenic
1025188792 7:56881324-56881346 GAGGAGAGGCCGGGGCAGGAGGG + Intergenic
1025206950 7:56999190-56999212 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
1025254249 7:57372860-57372882 CAGGAGAAGCTAGAGCAGCACGG + Intergenic
1025664989 7:63577706-63577728 CTCGGGAGGCTGAGGCAGGAAGG - Intergenic
1025683143 7:63695596-63695618 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1025684546 7:63705400-63705422 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1025825548 7:65007726-65007748 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1025898554 7:65725538-65725560 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1026232863 7:68500400-68500422 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1026280225 7:68915694-68915716 TTTGAGAGGCTGAAGCAGGAGGG + Intergenic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1026399819 7:69998287-69998309 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1026538550 7:71260700-71260722 CTTGGGAGGCTGACGCAGGAGGG - Intronic
1026633217 7:72057046-72057068 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1026780056 7:73260257-73260279 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1026825245 7:73577749-73577771 CATGGGAGGCCGAGGCAGGAGGG - Intronic
1026867956 7:73834909-73834931 CTGGACAGGCTGGAGCAGGCTGG - Exonic
1026926165 7:74195379-74195401 CAGGAGTGGCGGCTGCAGGACGG - Exonic
1027020911 7:74813675-74813697 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1027067114 7:75132249-75132271 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1027585382 7:80050929-80050951 TTGGGGAGGCCGAAGCAGGAGGG + Intergenic
1027689811 7:81330317-81330339 TATGAGAGCCAGAAGCAGGAAGG + Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028159743 7:87472316-87472338 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1028406125 7:90475849-90475871 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028475081 7:91244565-91244587 CAGGAGATCCTGAGGCAGCAGGG - Intergenic
1029217299 7:98959820-98959842 TAGAAGAGCCTAAAGCAGGAGGG + Intronic
1029369701 7:100141133-100141155 CTCGGGAGGCTGAGGCAGGAAGG - Intergenic
1029474718 7:100776208-100776230 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1029591900 7:101512512-101512534 CTAGGGAGGCTGAGGCAGGAGGG + Intronic
1029626781 7:101724788-101724810 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1030287141 7:107838291-107838313 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1030482046 7:110116584-110116606 TTTGAGAGTCTGAAGCAGGAGGG + Intergenic
1030663557 7:112249227-112249249 CAGGATGGGCTGAGGCAGGAGGG + Intronic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031054026 7:116974397-116974419 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1031102918 7:117504644-117504666 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1031567166 7:123314530-123314552 CAGCAGGGTCTGAAGCAAGAAGG + Intergenic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032047318 7:128620978-128621000 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1032073222 7:128822659-128822681 CATCCCAGGCTGAAGCAGGAAGG + Intergenic
1032104054 7:129010273-129010295 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1032208071 7:129886676-129886698 CAGGAGAGTAGGAAGCAGGTGGG - Intronic
1032327976 7:130950203-130950225 TGGGAGAGGCTGAGGAAGGATGG + Intergenic
1032646071 7:133825250-133825272 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1032811715 7:135426104-135426126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1033052061 7:138014611-138014633 CTTGGGAAGCTGAAGCAGGAGGG - Intronic
1033217878 7:139506743-139506765 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1033424392 7:141230860-141230882 CAGCAGAGGCTGAACCTTGAAGG + Intronic
1033524122 7:142193541-142193563 CAGCAGAGGATGTAGCATGAAGG - Intronic
1033705206 7:143879870-143879892 CAGCAGAGGCTGAGGGAGAAGGG - Intronic
1033737413 7:144236520-144236542 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1033745643 7:144314427-144314449 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1033796888 7:144856005-144856027 CTAGGGAGGCTGAGGCAGGAGGG - Intergenic
1033858741 7:145598489-145598511 GATGAGAGCCTGAGGCAGGAAGG + Intergenic
1033993620 7:147318332-147318354 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1034163497 7:149009036-149009058 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1035367004 7:158355560-158355582 CAGGAGAGGCAGGAGCAGTCAGG + Intronic
1035430896 7:158820676-158820698 CTGGGGAGGCTGAGGCGGGAGGG + Intronic
1035438257 7:158875618-158875640 CTGGGGAGGCTGAAGCACCAAGG - Intronic
1035572973 8:686050-686072 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1035612971 8:980678-980700 AAGGAGAGACTCCAGCAGGAAGG + Intergenic
1035768308 8:2126656-2126678 CGGGAGAGGCTGATGGAGGCTGG + Intronic
1035768341 8:2126770-2126792 TAGGAGAGGCTGATGGAGGCTGG + Intronic
1035785590 8:2257962-2257984 TAGGAGAGGCTGAGGAAGGTTGG + Intergenic
1035807217 8:2463754-2463776 TAGGAGAGGCTGAGGAAGGTTGG - Intergenic
1036371194 8:8164247-8164269 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1036879708 8:12501401-12501423 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1036909468 8:12742831-12742853 CTCGAGAGGCTGAAGTGGGAAGG - Intronic
1037463926 8:19140424-19140446 CATGAGATGATGCAGCAGGAAGG + Intergenic
1037881379 8:22575039-22575061 GAGGAAACGCTGGAGCAGGATGG - Exonic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038150271 8:24937219-24937241 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1038163229 8:25060482-25060504 TTTGAGAGGCTGAGGCAGGACGG - Intergenic
1038269793 8:26065945-26065967 CAGGAGAGACTGTAGGGGGATGG - Intergenic
1038301173 8:26350506-26350528 CTGGGGAGGCTGAAGTGGGAAGG - Intronic
1038627347 8:29206969-29206991 CAGGAGGGCATGAAGCAGGGTGG - Intronic
1038763946 8:30410280-30410302 CAGGAGAGGCTGAGGTTGCAGGG - Intronic
1038807622 8:30809827-30809849 CTTGAGAGGCTGAAGTGGGAGGG + Intronic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039047934 8:33466995-33467017 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039567049 8:38559310-38559332 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1039821779 8:41141398-41141420 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1039893115 8:41697657-41697679 CCGGACAGGCTCAGGCAGGAGGG - Intronic
1039963022 8:42264262-42264284 CTGGGGAGGCTGAGGTAGGAGGG - Intergenic
1040915274 8:52562557-52562579 CAGGAAACCCTGAGGCAGGAGGG - Intronic
1041122249 8:54599057-54599079 AAGGAGAGGAGGAAGCAGGTGGG - Intergenic
1041148819 8:54910575-54910597 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1041268086 8:56084336-56084358 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041502043 8:58549673-58549695 CTAGAGAGGCTGAGGCAGGAGGG - Intergenic
1041675077 8:60530251-60530273 CTTGAGAGGCTGAGGCAGAACGG - Intronic
1041770291 8:61465767-61465789 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1041893814 8:62901360-62901382 CATGGGAAGCTGAGGCAGGAGGG + Intronic
1041967202 8:63692719-63692741 CACGATAGTCAGAAGCAGGATGG - Intergenic
1042138153 8:65652047-65652069 CATGGGAGGCTGAGGCAGGAGGG - Intronic
1042141184 8:65680269-65680291 CAGGAGAGTCTAAAGCAGGAAGG - Intronic
1042525573 8:69761443-69761465 AAGGAAAGACGGAAGCAGGAGGG - Intronic
1042659408 8:71137115-71137137 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1042792566 8:72624820-72624842 AAGGAGAGGCTCCAGCAGGAGGG - Intronic
1043874068 8:85464562-85464584 CAGGTGGTGCTGAAGCTGGAGGG - Intronic
1044668606 8:94655947-94655969 CTCCAGAGGCTGAAGCTGGAGGG + Intronic
1044868755 8:96598109-96598131 CATGTGAGGATGCAGCAGGAAGG - Intronic
1044950110 8:97427644-97427666 CAGGAGAGGTGGCAGTAGGAAGG + Intergenic
1044980036 8:97707508-97707530 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1045014525 8:97988516-97988538 CTCGAAAGGCTGAGGCAGGAGGG + Intronic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045268132 8:100638060-100638082 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1045418815 8:101993664-101993686 CAGGAGAGGCAGGAGCAGCCTGG - Intronic
1045531999 8:102994074-102994096 CTCGAGAGGCTGAGGCAGAATGG - Intergenic
1045856326 8:106769568-106769590 GAGGAGAGGCCCGAGCAGGATGG - Exonic
1045964419 8:108007830-108007852 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1046824214 8:118669624-118669646 TTGGGGAGGCTGAAGCAGGAGGG + Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047020635 8:120771975-120771997 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1047097883 8:121642964-121642986 AAACAAAGGCTGAAGCAGGAAGG - Intergenic
1047464679 8:125100801-125100823 TTTGGGAGGCTGAAGCAGGAGGG - Intronic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1048019264 8:130523364-130523386 GAGGAGATGCTCAAGAAGGAAGG - Intergenic
1048297717 8:133226974-133226996 CACGAGAGGCAAAGGCAGGAGGG + Intronic
1048798263 8:138171654-138171676 CGGCTGAGGCTGCAGCAGGAAGG + Intronic
1049203690 8:141353659-141353681 CAGAGGAGGCTGAAGTGGGAAGG + Intergenic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049574320 8:143383428-143383450 CAGGAGCGGCCCAAGCAGGCTGG - Exonic
1049579424 8:143404618-143404640 GAGGAGAGGCTGGGGCAGGCGGG + Intergenic
1049592916 8:143470664-143470686 CAGGACCGGGTGCAGCAGGAGGG + Intronic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1049879115 8:145050075-145050097 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050677162 9:8069318-8069340 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1051226899 9:14908759-14908781 CAGGTGATTCTGAAGCAGGTGGG - Intronic
1051241085 9:15056677-15056699 CTCGGGAGGCTGAGGCAGGAAGG + Intergenic
1051863472 9:21652146-21652168 GAGGAGGAGCTGAAGCAGGGTGG - Intergenic
1052217288 9:25982668-25982690 CAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1052361930 9:27571561-27571583 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1053106887 9:35416988-35417010 CAGTTGTGGCTGAAGCAGGTGGG - Intergenic
1053201333 9:36153501-36153523 TGGGGGAGGCTGAGGCAGGATGG - Intronic
1053282943 9:36832829-36832851 CTTGAGAGGCTGAGGCAAGAGGG + Intergenic
1053336750 9:37281121-37281143 CTCAGGAGGCTGAAGCAGGAGGG - Intronic
1053379922 9:37640290-37640312 CTGGTAGGGCTGAAGCAGGAGGG + Intronic
1053806110 9:41803629-41803651 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1055446833 9:76392791-76392813 CCAGAGAGGCTGAGGCAGGAGGG + Intronic
1055533622 9:77213606-77213628 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1055708251 9:79031882-79031904 CAGGAGGGGAAGAAGAAGGAGGG + Intergenic
1056396870 9:86189204-86189226 CTCGGGAGGCTGAAGCAGGAGGG + Intergenic
1056412264 9:86341727-86341749 CAGGAGAGGGGGAAACGGGAGGG - Intronic
1056450745 9:86714433-86714455 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1056594753 9:87997795-87997817 CATGTGAGGATGAAGCAAGAAGG + Intergenic
1056629353 9:88280397-88280419 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1056784491 9:89580450-89580472 CAAGAGAGGAGGTAGCAGGATGG - Intergenic
1056881661 9:90399937-90399959 CTCGAGAGGCTGAGGCAGAATGG - Intergenic
1057041777 9:91853333-91853355 CAGGTGAGGTGGAAGAAGGAGGG + Intronic
1057218754 9:93244388-93244410 CAGGAGAGTATGAAGGTGGAGGG - Intronic
1057373072 9:94491483-94491505 ATGGGGAGGCTGAGGCAGGAGGG + Intergenic
1057783397 9:98068703-98068725 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1057804575 9:98211120-98211142 TAGCAGTGGCTGAACCAGGATGG - Intronic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058672416 9:107371153-107371175 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1058774954 9:108273879-108273901 AGGGAGGGGCTGAACCAGGATGG - Intergenic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1059002518 9:110364978-110365000 TTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1059175267 9:112164437-112164459 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1059326029 9:113504458-113504480 CAGCAGAGGCTAATGCAGGGAGG - Intronic
1059440267 9:114302616-114302638 CAGGAGAGGTTGAACCCGGGAGG + Intronic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1060101411 9:120843687-120843709 CTCGGGAGGCTGAAGCGGGAGGG + Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060199449 9:121644061-121644083 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1060395888 9:123316233-123316255 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060400039 9:123343197-123343219 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060502052 9:124165702-124165724 CTAGGGAGGCTGAGGCAGGAGGG + Intergenic
1060539985 9:124422869-124422891 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1060580324 9:124739560-124739582 CTTGGGAGGCTGAAGTAGGAGGG - Intronic
1060585042 9:124780445-124780467 CAGGAGGGGCTAGAGCAGGCAGG + Intronic
1060680109 9:125554686-125554708 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1060800372 9:126540814-126540836 CTCGGGAGGCTGAGGCAGGATGG + Intergenic
1061120772 9:128641012-128641034 AAGGAGGGGGTCAAGCAGGAGGG - Intronic
1061136724 9:128738787-128738809 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1061273805 9:129558294-129558316 CAGTGGAGGCTGGAGCAGGATGG - Intergenic
1061291043 9:129650451-129650473 CGAGAGAGGCAGAGGCAGGAAGG + Intergenic
1061344768 9:130014357-130014379 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1061357855 9:130119929-130119951 CTTGAGAGGCTGAGGTAGGAGGG - Intronic
1061382577 9:130267051-130267073 CTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1061745817 9:132739649-132739671 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1061752932 9:132793188-132793210 CAGGTGAGGATGAAGCAAGAAGG - Intronic
1061779390 9:132986856-132986878 AAGAAGAGGCTGCTGCAGGAGGG - Intronic
1061801144 9:133114004-133114026 CAGGAGGGGCTGAAGCCAGGTGG + Intronic
1061877095 9:133549625-133549647 TATGAGAGGCTGAGGCAGGAGGG - Intronic
1061966969 9:134020447-134020469 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
1061967647 9:134025284-134025306 GAGGAGGGGCTGGAGGAGGAGGG - Intergenic
1061967653 9:134025299-134025321 GAGGAGGGGCTGGAGGAGGAGGG - Intergenic
1062074307 9:134576065-134576087 CAGGGGAGGCCCAGGCAGGAAGG + Intergenic
1062604647 9:137341071-137341093 TTTGGGAGGCTGAAGCAGGAGGG + Intronic
1062679090 9:137767225-137767247 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1062729815 9:138102643-138102665 CAGGAGGAGCGGCAGCAGGAGGG - Intronic
1062750163 9:138246726-138246748 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1203779986 EBV:95945-95967 CGGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780101 EBV:96257-96279 GAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780114 EBV:96290-96312 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780133 EBV:96341-96363 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780138 EBV:96356-96378 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780143 EBV:96371-96393 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780148 EBV:96386-96408 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780157 EBV:96410-96432 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780166 EBV:96434-96456 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780195 EBV:96512-96534 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780204 EBV:96536-96558 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780213 EBV:96560-96582 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780228 EBV:96602-96624 GAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203734750 Un_GL000216v2:126090-126112 CTAGGGAGGCTGAAGCAAGATGG - Intergenic
1185553369 X:1001657-1001679 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185595760 X:1305743-1305765 CAGGAGAAACTGAGGCAGGGTGG + Intronic
1185621959 X:1455469-1455491 CAGGAGCGGGAGAGGCAGGAAGG - Intergenic
1185643466 X:1600888-1600910 CAGGACGGGCTGCAGCAGGTCGG - Exonic
1185666319 X:1768199-1768221 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1186027908 X:5334046-5334068 CTTGAGAGGCTGAGGTAGGAGGG + Intergenic
1186343502 X:8667401-8667423 CTCTGGAGGCTGAAGCAGGAGGG - Intronic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187474654 X:19600274-19600296 CTCGGGAGGCTGAGGCAGGAGGG + Intronic
1187486621 X:19710218-19710240 CCGGACAGGATGGAGCAGGATGG - Intronic
1187683038 X:21787322-21787344 CTCGAGAGGCTGAGGCGGGAGGG - Intergenic
1187794012 X:22981305-22981327 CTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1188130454 X:26424012-26424034 CAAGGGAGGCTGAGGCGGGAGGG + Intergenic
1188549668 X:31349332-31349354 CTAGGGAGGCTGAGGCAGGAGGG + Intronic
1188924671 X:36024326-36024348 GAAGAGAGGCAAAAGCAGGAAGG - Intergenic
1188994927 X:36872472-36872494 CTTAAGAGGCTGAAGCAGGAGGG + Intergenic
1189281352 X:39821747-39821769 CGGGCGAGGCTGAGGCAGCATGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190074876 X:47309657-47309679 CTCAAGAGGCTGAAGAAGGAGGG - Intergenic
1190196144 X:48320146-48320168 CATGGGAGGCTGAGGCAGGAGGG + Intergenic
1190210337 X:48441871-48441893 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1190270168 X:48856776-48856798 CTCGGGAGGCTGAGGCAGGAGGG + Intergenic
1190282503 X:48940279-48940301 CGGGAGAGGCTGAAGGAAGCTGG + Intronic
1190301974 X:49062341-49062363 CAGGGGAGGAGGCAGCAGGAGGG - Intronic
1190623575 X:52313706-52313728 GAGGAGGGGCTGAAGCATGGAGG - Intergenic
1190662850 X:52670493-52670515 CATGGGAGGCTGAGGCAGGAGGG + Intronic
1190676573 X:52787989-52788011 CATGGGAGGCTGAGGCAGGAGGG - Intronic
1190762890 X:53451280-53451302 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1190835257 X:54094787-54094809 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1191741828 X:64444418-64444440 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1191845733 X:65546477-65546499 CATGTGAGGATGAAGCAAGAAGG - Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192199874 X:69060132-69060154 GAGGTGAGGCTGAAGCAGTTGGG + Intergenic
1192420693 X:71027480-71027502 TTTGGGAGGCTGAAGCAGGAGGG + Intergenic
1192569343 X:72190041-72190063 CAGGATTGGCGGAGGCAGGAAGG - Intronic
1192618739 X:72655163-72655185 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1193123656 X:77849182-77849204 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1193513114 X:82430675-82430697 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1195612712 X:106887068-106887090 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1195664433 X:107416042-107416064 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1195671154 X:107471148-107471170 CACAAGGGGCTGAAGCAGGAGGG + Intergenic
1195798328 X:108678621-108678643 CTTGAGAGGCTGGGGCAGGAGGG + Intronic
1196056533 X:111362297-111362319 GAGGAGAGGATGAAGAATGAAGG - Intronic
1196063601 X:111438156-111438178 CATGGGAGGCTGAGGCAGGAGGG + Intergenic
1196681014 X:118469618-118469640 TTTGGGAGGCTGAAGCAGGAGGG - Intergenic
1196946678 X:120833355-120833377 CAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1197017060 X:121637536-121637558 CATGTGAGGGTGCAGCAGGAAGG - Intergenic
1197372593 X:125642877-125642899 CTTGAGAGGCTGAAGCAAGAAGG + Intergenic
1197695643 X:129547119-129547141 CTTGGGAGGCTGAAGCAGGAGGG + Intronic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1199514984 X:148665965-148665987 GTGGGGAGGGTGAAGCAGGATGG + Intronic
1199761637 X:150908961-150908983 CTTAAGAGGCTGAGGCAGGAGGG + Intergenic
1200223645 X:154404714-154404736 CAGGTGAGGCTGTCCCAGGATGG + Intronic
1200427733 Y:3040015-3040037 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1201269310 Y:12239108-12239130 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1201782220 Y:17736203-17736225 CACGGGAGGCTGAGGCAGAATGG - Intergenic
1201819333 Y:18169785-18169807 CACGGGAGGCTGAGGCAGAATGG + Intergenic