ID: 1009820823

View in Genome Browser
Species Human (GRCh38)
Location 6:68798853-68798875
Sequence CAGCTTTTCTGGGAGATCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009820823_1009820829 25 Left 1009820823 6:68798853-68798875 CCGTGGATCTCCCAGAAAAGCTG 0: 1
1: 0
2: 0
3: 21
4: 253
Right 1009820829 6:68798901-68798923 CTTCACGAGTGAAAGGACAATGG 0: 1
1: 0
2: 1
3: 11
4: 136
1009820823_1009820828 18 Left 1009820823 6:68798853-68798875 CCGTGGATCTCCCAGAAAAGCTG 0: 1
1: 0
2: 0
3: 21
4: 253
Right 1009820828 6:68798894-68798916 ATAGAAGCTTCACGAGTGAAAGG No data
1009820823_1009820830 26 Left 1009820823 6:68798853-68798875 CCGTGGATCTCCCAGAAAAGCTG 0: 1
1: 0
2: 0
3: 21
4: 253
Right 1009820830 6:68798902-68798924 TTCACGAGTGAAAGGACAATGGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009820823 Original CRISPR CAGCTTTTCTGGGAGATCCA CGG (reversed) Intronic
900236177 1:1592214-1592236 CAGCTTCTCTTGGTGATCCTTGG - Intergenic
900764871 1:4498045-4498067 CAGCCTTTCTGGGCCATGCATGG + Intergenic
900940725 1:5796934-5796956 CAGGTTTTCTAGGAGACACAAGG + Intergenic
901879013 1:12182995-12183017 CAGCTCTTCTGGGATAGCCTTGG + Intronic
902334730 1:15748366-15748388 CAGCTCTTCTGGCAGGTCCTGGG + Intergenic
902696630 1:18144646-18144668 CAGCTTTTCTTGGTGGTCTAAGG - Intronic
903142080 1:21345021-21345043 CAGCTTGGCTTGGAGACCCAGGG - Intronic
903943896 1:26950024-26950046 CACCCTTTCTGGGAGAAGCATGG - Exonic
904199380 1:28810038-28810060 CAATTTTTCTTGTAGATCCAAGG + Intergenic
904800101 1:33086509-33086531 CAGCTTTTCTTGGAAGGCCAAGG + Intronic
907212423 1:52835132-52835154 CAGCCACTCTGAGAGATCCATGG + Intergenic
907897827 1:58708999-58709021 CAGGATTCCTGGGAGGTCCAAGG - Intergenic
909212962 1:72847690-72847712 CAGCTTTTCCTGAAGATACAAGG + Intergenic
911905516 1:103563803-103563825 TAGGATTTCTGGCAGATCCATGG - Intronic
912637373 1:111310171-111310193 TAGCTTTTTTGGCAGTTCCAAGG - Intronic
912852945 1:113142783-113142805 CCGCTGCTCTGGGACATCCAAGG + Intergenic
914764148 1:150623074-150623096 CTGCCTTTCTGGGATATCCATGG + Intronic
915004864 1:152626661-152626683 TCCCTTTCCTGGGAGATCCAGGG + Intergenic
915922671 1:159988513-159988535 CAGCTCTTCTGGGATTTTCATGG - Intergenic
915996133 1:160565814-160565836 CAGCTCCTCAGGGAGCTCCAAGG - Intronic
916689819 1:167179587-167179609 CAGCTTGGCTGGGAGGTTCAAGG - Intergenic
918602056 1:186375526-186375548 CAGCTCTTCAGGGAGGGCCAAGG - Intronic
919008487 1:191929436-191929458 CAGCATTTCTGGGCCTTCCATGG + Intergenic
920237030 1:204514797-204514819 CTGCATAGCTGGGAGATCCAGGG - Intergenic
920835002 1:209502531-209502553 CACCATTTCTGGGGGATGCAGGG + Intergenic
920946062 1:210529612-210529634 CAGCTTCTCAGGGACATCAAAGG + Intronic
922246188 1:223800122-223800144 CAGATTTTCAGGGAGATTTAGGG - Intronic
923398321 1:233589817-233589839 CAGCTTTTCCAGGCCATCCATGG + Intergenic
923667067 1:236007794-236007816 CAGCTTTCCTGGGTGGTCCCTGG - Intronic
1063135226 10:3210376-3210398 CAGCTCTCCTGAGACATCCACGG + Intergenic
1064024035 10:11832777-11832799 AAGCTTTTCTTTTAGATCCAAGG + Intronic
1064093046 10:12401639-12401661 CAGTTTGTCTGGGAGACTCAGGG + Intronic
1066763117 10:38776084-38776106 CAGTTTTTGTGAGAGATTCAGGG + Intergenic
1069144877 10:64878451-64878473 CAGCTTCTCTGGCATTTCCATGG + Intergenic
1069680024 10:70277719-70277741 CAGCCTTTCTGGGAGCCCCCAGG - Intronic
1071043345 10:81341052-81341074 TAGATTTTCTGGGAAAGCCATGG - Intergenic
1071131633 10:82400503-82400525 CAGCTTTTCTGTTTGATCCATGG - Intronic
1072579291 10:96725921-96725943 GAGCTTGTTTGGGAGCTCCACGG - Intergenic
1073273539 10:102288143-102288165 CCGTTTTGCTGGGACATCCATGG + Intronic
1075071669 10:119324031-119324053 CAGCTTTTCTGGGAGCTCACAGG + Intronic
1075098580 10:119490003-119490025 ATGCTTTTCTGGGAGGTCCCGGG - Intergenic
1075621624 10:123932469-123932491 CAGACTTTCTGGGAAATCTATGG - Intronic
1076150303 10:128156927-128156949 CAGCTTTTCTTGAAGACACAAGG - Intergenic
1076755141 10:132566080-132566102 CAGGTTTCCTTGGAGAACCAAGG - Intronic
1077467239 11:2739166-2739188 CAGCATGTCTGGGAGGGCCAGGG + Intronic
1080732198 11:34968513-34968535 ATGCTTTTTTGAGAGATCCAAGG + Intronic
1081489935 11:43559391-43559413 CAGCCTTCCCCGGAGATCCATGG + Intronic
1081702055 11:45158376-45158398 CAGCCTGTCTGGGAGCTGCAGGG - Intronic
1081833485 11:46134713-46134735 AAGCTTCTCTGGGAGAAGCAGGG - Intergenic
1082977214 11:59085055-59085077 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1083011155 11:59400967-59400989 CAGCTGCTCTGAGAGATCAAAGG - Intergenic
1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG + Intronic
1086163405 11:83748836-83748858 CTGCTTTTCTGGGAAATGGAGGG - Intronic
1088660104 11:112036698-112036720 CAGCTTTACTGGGATTTCTATGG - Intronic
1090990070 11:131809300-131809322 CAGCTTTCTTGGGAGATCTTGGG + Intronic
1097180861 12:57171139-57171161 CAGCTTATCTGGGAGCGGCAGGG - Intronic
1097186236 12:57198023-57198045 CAGCTCTGGTGGGAGAACCATGG - Intronic
1097864150 12:64545022-64545044 TAGCTTTTCTGGCAGATTGATGG + Intergenic
1098889697 12:75996928-75996950 GAGTTATTCTTGGAGATCCAAGG + Intergenic
1100223497 12:92532316-92532338 CAGCTTTTCTTGGTGGTACATGG - Intergenic
1100440764 12:94615217-94615239 CAGATTTCCTGTGAGATCAAAGG + Intronic
1101188256 12:102304724-102304746 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1101496057 12:105255372-105255394 CAGTCTTTCTGGGAGAGCCGAGG - Intronic
1101568325 12:105930646-105930668 CAGGTTCTCTGGGAAACCCAGGG - Intergenic
1102192475 12:110999112-110999134 CAGCTGGTCTGGGAGATCCCAGG - Intergenic
1104266838 12:127241315-127241337 CAGCTATCCTGGGAATTCCACGG + Intergenic
1106925698 13:34610662-34610684 GAGATCTTCTGGGAGCTCCAAGG - Intergenic
1107974029 13:45672160-45672182 GAGCTTTTCTGGGATAAACAGGG + Intergenic
1109061857 13:57631033-57631055 CAGTTTTTCTGGGCGACTCAGGG - Intergenic
1114854980 14:26427853-26427875 CAGTTTTCTTGGGAAATCCAGGG + Intergenic
1115879527 14:37899503-37899525 CTGCTTTGCCGGGAGCTCCAGGG - Intronic
1116678597 14:47937978-47938000 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1116809512 14:49525652-49525674 CAGTTTTCCTGGGAAAACCATGG + Intergenic
1118326942 14:64787629-64787651 CATCTTTTCTCTTAGATCCAAGG - Intronic
1118753522 14:68822747-68822769 CAGCTCATCTGGGAGTTCCCTGG - Intergenic
1119162051 14:72460818-72460840 GAGCCTGTCTGGGAGACCCATGG + Intronic
1120684902 14:87527143-87527165 CAGCCTTTCTGTCAGAACCAGGG + Intergenic
1121387974 14:93546897-93546919 CAGATTGTCTCTGAGATCCATGG - Intronic
1122083773 14:99285385-99285407 CTGCTTGTCTGGGAGCTCCTTGG + Intergenic
1128114317 15:65095830-65095852 GAGCTGCTCTGGGAGAACCAGGG + Intronic
1129640613 15:77373302-77373324 CATCTTTTTTGGGAAAACCAGGG - Intronic
1129801479 15:78418240-78418262 CAGCTCTTCCGGCAGACCCATGG - Intergenic
1131145241 15:90006889-90006911 CAGCTTTGCTGGGAGCTCATTGG + Intronic
1132298409 15:100761439-100761461 CAGCACTTTTGGGAGATGCAAGG + Intergenic
1134113388 16:11530316-11530338 CATCTATTCTTTGAGATCCAGGG - Intergenic
1135893927 16:26381360-26381382 CTGCCTTTCTGGGAGACACAAGG + Intergenic
1136588448 16:31202523-31202545 CAGCTTGTCGGTGAGGTCCAAGG + Exonic
1138103889 16:54276627-54276649 CAACTTTGCTGAGAGATCCAGGG + Intergenic
1138305039 16:55966695-55966717 CAGGCTTGCTGGGAGATGCATGG - Intergenic
1138336663 16:56258784-56258806 CAGCTCCTCTGGGAGAGACAGGG + Intronic
1138394002 16:56690715-56690737 CACCTTTTCAGGGTGATCCCTGG + Intronic
1139125073 16:64068129-64068151 CAGCTTTTATGGGAAATGCAGGG - Intergenic
1139137158 16:64218335-64218357 CAGCTTTACTGGGAAAGACATGG - Intergenic
1140227907 16:73093443-73093465 CAGCTCTTTTGGGGGTTCCAGGG + Intergenic
1140535825 16:75708567-75708589 TAGCTTTTCTGGGAGAAATAGGG - Intronic
1141149340 16:81553229-81553251 CTGCTTTTCTGGAAGATGAAGGG + Intronic
1141407282 16:83805692-83805714 CAGGTTTGCTCAGAGATCCAGGG + Intergenic
1141842235 16:86580321-86580343 CAGGTTTTCTGAGAGATGTAGGG + Exonic
1141952696 16:87348854-87348876 CAGTTGTTCTGCGGGATCCAGGG - Intronic
1143963170 17:10737359-10737381 CAGGCTTCCTGGGAGAGCCAAGG - Intergenic
1144052322 17:11507587-11507609 CATCATTTCTCAGAGATCCAGGG - Intronic
1145259594 17:21346836-21346858 TGGCTTTCCTGGAAGATCCAGGG + Intergenic
1145317024 17:21741112-21741134 TGGCTTTCCTGGAAGATCCAGGG - Intergenic
1145728215 17:27153419-27153441 CATCTTCTCTGGGGGATCCATGG - Intergenic
1146635684 17:34502666-34502688 CAGCTTCTCTGTGAGTTCAAGGG + Intergenic
1146793939 17:35768333-35768355 CAGCTTTCCTGGGAGCTGGACGG + Exonic
1147041716 17:37724369-37724391 CAGCTGTTCTGACAGGTCCAGGG + Intronic
1148621801 17:49040101-49040123 CAGCTTTTCTTGGATCTTCAGGG + Intronic
1148765253 17:50035136-50035158 CTGCTTTTGTGGGAAAACCAAGG - Intergenic
1149394662 17:56227386-56227408 AAGCTTTTGTGGGAGATGCGAGG - Intronic
1152184636 17:78846821-78846843 GACCTTTTCTGGAATATCCATGG + Intergenic
1156348780 18:36284494-36284516 CAGCCTTTCTTGGAGATCCGAGG - Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157910755 18:51615494-51615516 CTCCCTTTCTGGGAGATCCAGGG - Intergenic
1160013597 18:75124893-75124915 CAACTTCTTTGGGAGAGCCAAGG - Intergenic
1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG + Exonic
1162283503 19:9719572-9719594 CAGGTGTGCTGGGAAATCCAGGG - Intergenic
1162573228 19:11484237-11484259 CTGCAGTCCTGGGAGATCCAAGG - Intronic
925262974 2:2544038-2544060 CAGCTTTTCTGGGCCACACAGGG - Intergenic
927427227 2:22995100-22995122 CAGCTACTATGGCAGATCCAGGG - Intergenic
929159581 2:38818116-38818138 CAGCTTTTCAGAGGGGTCCATGG - Intronic
933308210 2:80628720-80628742 CAGCTTTTCTGGGAGGTAGAGGG + Intronic
933770048 2:85737851-85737873 CAGCCTTTTTGGGACCTCCAAGG + Intergenic
934306810 2:91831995-91832017 CAGTTTTTGTGAGAGATTCAGGG - Intergenic
934326446 2:92020747-92020769 CAGTTTTTGTGAGAGATTCAGGG + Intergenic
936051513 2:109227560-109227582 CTGCTTCTCTGGGAGATCCCTGG + Intronic
937500368 2:122471915-122471937 CTGCTCTTCAGGGAAATCCAGGG + Intergenic
938102325 2:128505488-128505510 CAGATTTTCTGGGAGCTCAGTGG + Intergenic
938614412 2:132982519-132982541 CAGCTTTTATTTTAGATCCAGGG + Intronic
939295840 2:140263248-140263270 CAGTTTGGCTGGAAGATCCACGG - Intronic
941537982 2:166744948-166744970 CAGTTTTTCTGGGTGTTCCTTGG + Intergenic
943467146 2:188241804-188241826 GAGCTTTTCTGGGAGCTTGATGG + Intergenic
945384153 2:209177212-209177234 CAGCTTTTATATTAGATCCAGGG + Intergenic
945623880 2:212175795-212175817 AAGCCTTTCTGGCAGTTCCAGGG + Intronic
946001801 2:216488608-216488630 CAGCTTTTCTGTGGGCTCTATGG + Intergenic
946347584 2:219123736-219123758 CAGCTTTTCAGGCAGAGCTAAGG - Intronic
948469178 2:238166479-238166501 CTGCATTTCTGGGAGTTCCCAGG + Intronic
1169944271 20:10972214-10972236 AAGCATTTCTGGAAGAACCAAGG + Intergenic
1172324404 20:34023385-34023407 CAGTTTTGGTGGGAGAGCCATGG + Intronic
1172727736 20:37059323-37059345 CAGCTTTTCTTGGAGGACCAGGG + Intronic
1173470940 20:43323148-43323170 CATCTTTTCTGGAAGCTCTAGGG - Intergenic
1174364092 20:50045963-50045985 GAGCTTTCCTGGGCTATCCAGGG + Intergenic
1176884817 21:14243066-14243088 AAGCTAAACTGGGAGATCCACGG - Intergenic
1180240465 21:46500346-46500368 TAGCTTTCCTGGGTGTTCCATGG + Intronic
1180585962 22:16890511-16890533 CAGTTTTTGTGAGAGATTCAGGG + Intergenic
1180931228 22:19593277-19593299 CACCTGTTCTGGGAGATGCTCGG + Intergenic
1181271910 22:21664038-21664060 CAGACTTTATGGGAGATGCATGG + Intronic
1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG + Intronic
1183341956 22:37286515-37286537 CAGCGTTTCTGGGATCTGCATGG - Intronic
1183548349 22:38467415-38467437 AAGCTGGTCAGGGAGATCCAGGG - Intergenic
1183648254 22:39139086-39139108 CAGCTCTCCTGGGACATTCAAGG - Intronic
950114626 3:10442706-10442728 CAGCTTGTTTGGTAGATCAATGG - Intronic
950574055 3:13820585-13820607 CAGCTTTTCTGAGAAAATCAGGG + Intronic
950605952 3:14080254-14080276 CAGCTGCTCTGAGAGATCAATGG + Intronic
951229062 3:20155682-20155704 CAGCTATTCTGGAATATCAAAGG + Intergenic
952023968 3:29056715-29056737 CAGCTGCTTTGAGAGATCCATGG + Intergenic
952182212 3:30929407-30929429 CTGTTTTACTGAGAGATCCATGG - Intergenic
952443590 3:33358206-33358228 CAGCTTTTCTGTGAGAAGAAGGG - Intronic
952925975 3:38319361-38319383 CAACCTGCCTGGGAGATCCATGG - Intergenic
953186988 3:40647133-40647155 CAGCTTGTATGTGACATCCAAGG - Intergenic
953885104 3:46710551-46710573 CAGCTGTGCTGGGAGGTCCCAGG + Exonic
954437062 3:50502083-50502105 CAGGTTTTGTGGCAGAACCAGGG + Intronic
954996453 3:54886123-54886145 CTGCTTTTGAGGGACATCCAGGG - Intronic
957872260 3:86104378-86104400 CAGCTTTTCTGGGAGCCACAAGG - Intergenic
959005027 3:101010302-101010324 CAGCTCTTCTGGGAAAAACAAGG - Intergenic
960100245 3:113734440-113734462 CAGCTTTTATCTTAGATCCAGGG - Intronic
961338161 3:126197689-126197711 CAGCCATTCTGAGAGATCAATGG + Intronic
961990183 3:131181359-131181381 CTTCCTTTCTGGGGGATCCAAGG - Intronic
962505769 3:136045265-136045287 CAGCTGTGCTGGGTGAGCCAAGG - Intronic
964186561 3:153952335-153952357 CATGTTTTCTGGGAATTCCAGGG - Intergenic
964512438 3:157467589-157467611 CTGCATTTCTGGGACCTCCAGGG + Intronic
965425778 3:168520924-168520946 CAACTTTTCTTTTAGATCCAAGG + Intergenic
965486482 3:169284522-169284544 CAGCATTGCTTGGAGATTCAGGG - Intronic
965609675 3:170531016-170531038 CAGCATTTCTGAAAGATCCTTGG - Intronic
966775157 3:183537155-183537177 CTGCTCCTCTGGGAGATCCATGG + Intronic
968480371 4:830496-830518 CAGCTCGTCTGGGAGAGGCAGGG + Intergenic
969137744 4:5044240-5044262 AAGGTTTTCTTGGAGATGCAAGG - Intergenic
970380614 4:15503568-15503590 CTGCTTTCCAGGAAGATCCATGG - Intronic
971310151 4:25518701-25518723 GAGCTTTTCTGGGATATGTAGGG + Intergenic
975112497 4:70643147-70643169 CACCTTTTAAGGAAGATCCAGGG + Exonic
975499627 4:75070360-75070382 CATCTTTTCTGGGAGCCCCTTGG - Intergenic
975721083 4:77249191-77249213 CAACTTCTCTGGAAGAGCCATGG - Intronic
976080333 4:81347767-81347789 TAGTTTATTTGGGAGATCCAGGG + Intergenic
978416585 4:108483322-108483344 CAGCTTCACTGGGCCATCCAGGG - Intergenic
979819891 4:125158150-125158172 CAGCTTTGCAGGGTGATCCTAGG - Intergenic
981233423 4:142386927-142386949 CAGCTGCTCTGAGAGATCAATGG - Intronic
981248615 4:142571155-142571177 AAGCTTTTCTGGGGGTGCCAAGG - Intronic
981408733 4:144402495-144402517 GAGGTTTTCTGGGATATCCAAGG + Intergenic
981684792 4:147441511-147441533 CAGGAATTCTGGGAGATTCAAGG + Intergenic
981776556 4:148374841-148374863 CAGTCTTTTTGGGAGATACAGGG - Intronic
981910022 4:149968101-149968123 CAGTTTTTCTGGAGGATCAAGGG - Intergenic
983284395 4:165721167-165721189 CAGTGTTTCTGTAAGATCCATGG + Intergenic
983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG + Intronic
984418875 4:179494528-179494550 CATCATTTCTGGAAGCTCCAGGG + Intergenic
985288338 4:188360635-188360657 AAACTTTTCTAGAAGATCCATGG + Intergenic
985354912 4:189108503-189108525 CAGCTACTCTGAGAGATCAATGG - Intergenic
985354921 4:189108571-189108593 CAGCTACTCTGAGAGATCAATGG - Intergenic
988079175 5:26394360-26394382 CAGATTTTCTGCAAAATCCAAGG + Intergenic
989249248 5:39289600-39289622 CAGCTATTTTGGGAGATAGAAGG + Intronic
989337220 5:40331872-40331894 CAGCTGCTCTGAGAGATCAATGG + Intergenic
991969598 5:72126243-72126265 CAGCTCTTCAGGGAGCACCATGG - Intronic
992749437 5:79848977-79848999 CTGCTTTTCTGAGAGAGGCAGGG - Intergenic
993248408 5:85483073-85483095 CAGCTGCTCTGAGAGATCAAGGG - Intergenic
993523407 5:88934090-88934112 GGGCTTGTCTGGGAGCTCCACGG - Intergenic
994500465 5:100570574-100570596 TAGCTGTTCTGGGAAATCCTTGG - Intronic
995585089 5:113640524-113640546 GACCTTTTGTGGGAGATCGAAGG - Intergenic
998104964 5:139462627-139462649 CAGCTGTGCTGGGTGATCCTGGG - Exonic
999004796 5:147963874-147963896 CTGCTTTTCAGTGAAATCCAAGG + Intergenic
1002166774 5:177352403-177352425 CAGCTTTCCTGGGCCTTCCATGG - Intergenic
1006572705 6:35018545-35018567 CAACTTTTATGGTAGATTCAGGG + Intronic
1007213555 6:40217971-40217993 AAGGTGTTCTGGGTGATCCAAGG - Intergenic
1007962441 6:45972496-45972518 GGCCTTTTCTGGGAGTTCCAGGG - Intronic
1008715524 6:54284592-54284614 CAGAGTTTCTGGGAGATCATTGG - Intergenic
1009820823 6:68798853-68798875 CAGCTTTTCTGGGAGATCCACGG - Intronic
1014045550 6:116881329-116881351 AAGTTTTTCTGGGATATCCTAGG - Intronic
1015196477 6:130529457-130529479 CAGCTTTCCTGGTACATTCATGG - Intergenic
1020433785 7:8140506-8140528 CAGCTTTGGTGGGAGCTCCAAGG - Intronic
1022750314 7:33218363-33218385 CATATTTTCAGGGAAATCCAAGG - Intronic
1022904303 7:34840862-34840884 TAGTTTTTCTGAGAGACCCAAGG - Intronic
1023735737 7:43234602-43234624 AAGCTTTTCCTGGAGACCCAGGG + Intronic
1025810100 7:64870218-64870240 CGTCTTCTCTGAGAGATCCACGG + Intronic
1025812688 7:64885152-64885174 CCTCTTCTCTGGGGGATCCACGG + Intronic
1026489130 7:70847720-70847742 CAGGTGTGCTGGGAGCTCCAGGG - Intergenic
1027954190 7:84858653-84858675 AAGATTTTCTTGGAGATTCAAGG + Intergenic
1028047060 7:86134543-86134565 CAGCTATTATGGCAGAGCCAAGG + Intergenic
1028612773 7:92730940-92730962 CACATTTTATGGGAGAACCATGG - Intronic
1031310233 7:120187228-120187250 TGGATTTTCTAGGAGATCCAGGG + Intergenic
1032411007 7:131693207-131693229 CTGCTTTCCTGGGTGATGCAGGG + Intergenic
1032792075 7:135249838-135249860 CAGCTTTTCTGGGTTTTTCAGGG + Intronic
1032802762 7:135329639-135329661 CAGCTGTCCTGAGAGATCCTGGG + Intergenic
1040325517 8:46339562-46339584 CAGCTTTCCCGGGAAAGCCATGG - Intergenic
1041710324 8:60888480-60888502 TAAACTTTCTGGGAGATCCATGG - Intergenic
1043158781 8:76819548-76819570 CCGCTCTTCTGGGAGAACAATGG + Intronic
1044032977 8:87261272-87261294 CAGCTGCTCTGAGAGATCAATGG + Intronic
1046578850 8:116067088-116067110 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1047990316 8:130279329-130279351 CTGCTTCTCTGCCAGATCCATGG + Intronic
1048690166 8:136954130-136954152 CAGCTCCTGTGGGCGATCCAAGG - Intergenic
1048824654 8:138412203-138412225 CAGCTTTTATGTTAGATTCAAGG - Intronic
1048984906 8:139730152-139730174 CAGCTTGTCTGGGAGGTGGAAGG - Intergenic
1049100952 8:140578599-140578621 CATCTTTTTTGGGAGGTCAAGGG - Intronic
1049444896 8:142625375-142625397 CAGGGTTCCTGGGAGATTCATGG - Intergenic
1050657658 9:7847028-7847050 CAGCTGCTCTGAGAGATCAATGG - Intronic
1050722722 9:8609165-8609187 CAGCTTTTCTCAGAGATTGAAGG - Intronic
1050847610 9:10242536-10242558 CAGGCTTTCTGCTAGATCCAGGG + Intronic
1051357017 9:16248779-16248801 CTAATTTTCTGGGAGATTCAAGG - Intronic
1053694893 9:40628123-40628145 CAGTTTTTGTGAGAGATTCAGGG + Intergenic
1054269948 9:63011996-63012018 CAGTTTTTGTGAGAGATTCAGGG - Intergenic
1054306137 9:63427347-63427369 CAGTTTTTGTGAGAGATTCAGGG + Intergenic
1054404879 9:64751326-64751348 CAGTTTTTGTGAGAGATTCAGGG + Intergenic
1054438503 9:65236818-65236840 CAGTTTTTGTGAGAGATTCAGGG + Intergenic
1054491901 9:65785130-65785152 CAGTTTTTGTGAGAGATTCAGGG - Intergenic
1056193543 9:84207381-84207403 CAGCATTTCTGGGAATCCCAAGG - Intergenic
1056943452 9:90974748-90974770 TGGCTTTTCTGGGAGAACCACGG + Intergenic
1057455022 9:95200204-95200226 CAGCTTTGCTCTGAGATCCAGGG - Intronic
1060130258 9:121090154-121090176 CAGCTTTTTTGGTATATTCATGG + Intronic
1061144712 9:128790894-128790916 GAGCTTTTCTGGGAAGTCCTGGG + Intronic
1061486818 9:130924377-130924399 CAGCTTCTCTCTGAGAGCCAGGG - Exonic
1061517820 9:131099614-131099636 CAGCTTGGCTGGCAGATCTAGGG + Intronic
1061790291 9:133055592-133055614 CATCTTTTCTGGGAAAAGCAGGG - Intronic
1202777338 9_KI270717v1_random:1729-1751 CAGTTTTTGTGAGAGATTCAGGG + Intergenic
1186322853 X:8449100-8449122 AAGCCTTTCTGGAAGATCCCAGG + Intergenic
1186458977 X:9733354-9733376 CAGGTATTATGGGAGATGCAAGG + Intronic
1188073305 X:25744584-25744606 CAGCTGCTCTGAGAGATCAATGG + Intergenic
1188673958 X:32915422-32915444 CATCTTTTCTGGGAGAGGAAGGG + Intronic
1189212034 X:39291699-39291721 CATCTTTTCTGGAAGAAACATGG - Intergenic
1189235023 X:39480167-39480189 CAGCTTGGGTGGGAGATCCTGGG + Intergenic
1193251095 X:79291350-79291372 CAGCTCTTATGGGAGTGCCAAGG - Intergenic
1195298579 X:103504314-103504336 CAGCTTTTATTTTAGATCCAGGG - Intronic
1195380133 X:104262641-104262663 CAGCTCTTCTGGCAGTTCAAAGG + Intergenic
1195683387 X:107565007-107565029 CAGCTGTTCCGGGAGAACCAGGG + Exonic
1198498103 X:137214194-137214216 CAGCATCTCTGAGAGATCAATGG - Intergenic
1200462233 Y:3471732-3471754 CAGCTTCTCTGAGAGAGCAATGG - Intergenic
1200928874 Y:8679127-8679149 CATCTTCTCTGTGGGATCCATGG - Intergenic
1201192683 Y:11460006-11460028 CAGTTTTTGTGAGAGATTCAGGG + Intergenic
1201453484 Y:14142351-14142373 ATGCTTTCATGGGAGATCCAAGG - Intergenic