ID: 1009831032

View in Genome Browser
Species Human (GRCh38)
Location 6:68935307-68935329
Sequence AACTAGTGCTCTAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009831032 Original CRISPR AACTAGTGCTCTAGGGAAGA AGG (reversed) Intronic
902168500 1:14592095-14592117 AACATGTGCTCTGGGGAAAAGGG - Intergenic
910245314 1:85132590-85132612 AACAAGAGTTATAGGGAAGAAGG + Intronic
911267447 1:95760064-95760086 AACTAGTGTTATACAGAAGAGGG + Intergenic
913454034 1:119012788-119012810 AAATAGTCATCTAGGGAAGAGGG - Intergenic
915253803 1:154609823-154609845 AGCTAGTCTGCTAGGGAAGATGG + Intronic
916044366 1:160988115-160988137 AACTATTGCAGTAGGGAAGAGGG - Intergenic
917451797 1:175153514-175153536 CACTAGCTCTCTATGGAAGACGG + Intergenic
918488562 1:185055106-185055128 GACTAGGGCTTTAGGGAATAGGG + Intronic
918644064 1:186882259-186882281 AACTAGTTGACTAGGGAAGTGGG + Intronic
920095333 1:203483064-203483086 AACTAGAGCTCTAGGGAAGATGG - Intronic
921014465 1:211175749-211175771 AATTAGCCCTCTGGGGAAGAAGG - Intergenic
921199815 1:212793769-212793791 AGCTTGTGCTATAGGGAAGATGG + Intronic
921492155 1:215790449-215790471 GTCTAGTGCTCTTGGTAAGAAGG - Intronic
922349262 1:224722372-224722394 AACAAGTGCTCTAGGCAATTTGG + Intronic
922683082 1:227617099-227617121 AAGTAGTGTTCTATGGATGATGG - Intronic
1063288933 10:4721235-4721257 AACATGTACTCCAGGGAAGAAGG + Intergenic
1064147004 10:12833555-12833577 AACCATTGCTCTAGGGCTGAAGG + Exonic
1064583234 10:16815001-16815023 AATGAGTGCTGTAGGGAGGAAGG + Intronic
1067750280 10:48967156-48967178 AACATGTGCTCTGGGGCAGATGG + Intronic
1068942016 10:62689583-62689605 AACTAGTTAACTAGGGAAGGGGG + Intergenic
1070369667 10:75770513-75770535 AAGAACTGCTATAGGGAAGAAGG - Intronic
1075895327 10:125990001-125990023 AGTGAGTGCTCCAGGGAAGAAGG - Intronic
1076069019 10:127471175-127471197 AAGCAGTGCTCTTAGGAAGATGG + Intergenic
1077291727 11:1799047-1799069 AACTAGTGCTTTAGGGTGCATGG - Intergenic
1078644730 11:13130172-13130194 AACTACTGCTCAAGGAAATAAGG + Intergenic
1078753375 11:14186307-14186329 AACAAGTGGGCAAGGGAAGAAGG + Intronic
1079539019 11:21549826-21549848 AATTATTGCAATAGGGAAGAGGG + Intronic
1079703353 11:23579005-23579027 AACTATCGCTCTAGGTAATATGG - Intergenic
1085325958 11:75606758-75606780 AACTGCTGCTCTGGGGAAAATGG - Intronic
1086216554 11:84389301-84389323 TACTAGTGATCAAGGGAAGAGGG + Intronic
1087959178 11:104326552-104326574 TACTAATGCCCTGGGGAAGAGGG + Intergenic
1088047560 11:105472419-105472441 AATTAGTGATCTGGGCAAGATGG + Intergenic
1092008118 12:5086752-5086774 AACTTCTGTTCTACGGAAGAAGG + Intergenic
1098398638 12:70049760-70049782 AACTCCTGCTCCAGGAAAGAAGG + Intergenic
1098954813 12:76678501-76678523 AACTACTCCTCTAGAGAAGTAGG + Intergenic
1101282178 12:103269718-103269740 AACTCATGCTCTAGTGGAGAGGG + Intronic
1102718568 12:114996449-114996471 GAGTAGTGCTCTGGAGAAGACGG - Intergenic
1103767537 12:123291739-123291761 AAATAGAGCTGAAGGGAAGAGGG + Exonic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104300027 12:127556452-127556474 AAGTAGTTTTCTAGGGAAGTGGG + Intergenic
1104738468 12:131154597-131154619 AACTAGTGCTCTGAGGAACATGG - Intergenic
1105728801 13:23191282-23191304 TACTAAAGCTCTCGGGAAGATGG - Intronic
1106916073 13:34515636-34515658 AGCTTGGGCTCTAGGGAAAAAGG + Intergenic
1108049442 13:46416787-46416809 AACTAGTGTTCAATGGAATATGG + Intronic
1109400593 13:61822866-61822888 AACTGTGGCTCAAGGGAAGATGG + Intergenic
1111142403 13:84136856-84136878 AATTAGTTCCCAAGGGAAGAAGG - Intergenic
1111835405 13:93382846-93382868 AAATATTGCTTTAGGGAAGTAGG - Intronic
1111934597 13:94546422-94546444 TACTATTGCAATAGGGAAGAGGG - Intergenic
1113912392 13:113849152-113849174 AAGTTGTGTTCTAGGAAAGATGG + Intronic
1116745257 14:48809993-48810015 GACTACTGCAATAGGGAAGAGGG - Intergenic
1118315891 14:64725931-64725953 AACTAATGGTGTAGGGCAGAGGG + Intronic
1124862377 15:33454848-33454870 AACTAAGGCTATAGAGAAGAGGG + Intronic
1128151794 15:65367786-65367808 GGCTACTGCTCAAGGGAAGAGGG + Intronic
1128672667 15:69586200-69586222 TTCCTGTGCTCTAGGGAAGAGGG - Intergenic
1129118532 15:73380367-73380389 AACTATTGCAATAGGGAAAAGGG - Intergenic
1129130667 15:73490846-73490868 AAGTAGTTCTCTGGGGATGAAGG - Intronic
1130804141 15:87300902-87300924 AATTAATGTTCCAGGGAAGATGG - Intergenic
1131620704 15:94065361-94065383 AATTAGTGCTCAAGAGAACACGG - Intergenic
1133514207 16:6492242-6492264 AAATAGTCCTCTACAGAAGAAGG - Intronic
1134449631 16:14355196-14355218 AACTAGTGCCCTACTGAAGGGGG + Intergenic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136123901 16:28162415-28162437 ATCAAGTTCTCTATGGAAGAGGG + Intronic
1137956099 16:52831448-52831470 AAACAGTGTTCTAGGGAAAAGGG - Intergenic
1139918447 16:70442769-70442791 TACTATTGCAATAGGGAAGAGGG - Intergenic
1143313609 17:6014159-6014181 TACCAGTGCTCAAGGCAAGAGGG + Intronic
1145260533 17:21352062-21352084 AACTGGGGCTCTGGGCAAGATGG - Intergenic
1150184100 17:63161520-63161542 AATAAGTGCTTTGGGGAAGAGGG - Intronic
1150841046 17:68605653-68605675 GAGTAGTGCTCCAGTGAAGATGG - Intergenic
1152761951 17:82113268-82113290 AACCAGTGCTCTGGCCAAGAAGG - Intronic
1153331156 18:3876603-3876625 AGCTATTACTCTGGGGAAGAAGG + Intronic
1156917887 18:42483310-42483332 GAGCAGGGCTCTAGGGAAGAAGG - Intergenic
1156926904 18:42593091-42593113 AACTAGCTCTCTGGGGATGATGG - Intergenic
1157145807 18:45161285-45161307 AACTAGGGCTTTGGGGAAAAAGG - Intergenic
1159681755 18:71362427-71362449 TAGTAGTGCTCCAAGGAAGATGG - Intergenic
1160295706 18:77634770-77634792 CACTAGTGAAATAGGGAAGATGG - Intergenic
1163109888 19:15153246-15153268 AATTAATGGTCTAGGGAAGGAGG - Intergenic
1163296616 19:16416933-16416955 AACTAAGGCACTAGGCAAGAAGG + Intronic
1163337229 19:16681041-16681063 AGCTAGAGCTCTAGAGAAGAAGG - Intronic
1167194078 19:48014839-48014861 AAATAGTGCTCTCTGGATGAGGG + Intronic
926639068 2:15215817-15215839 AACTAGTGGTAGAGGGAGGATGG + Intronic
927331205 2:21866361-21866383 AACTGTTGCTGTAGGGAGGAGGG - Intergenic
933796022 2:85920377-85920399 TGCTCGTGCCCTAGGGAAGATGG - Intergenic
935836606 2:107061930-107061952 AACTACTGCTATATGGAATAAGG + Intergenic
939170365 2:138688514-138688536 AACCACTGCTCTAGGTAACAGGG - Intronic
939358080 2:141130497-141130519 AAATAGTGCTCTATAAAAGATGG - Intronic
940831765 2:158474631-158474653 CACCAGTGCCCTAAGGAAGACGG + Intronic
941368213 2:164632949-164632971 AACAAATGCTCCTGGGAAGAGGG + Intergenic
943518241 2:188913243-188913265 AAGTAGTCATTTAGGGAAGAGGG - Intergenic
943962925 2:194290383-194290405 AACTATTGCAGTGGGGAAGAGGG - Intergenic
944766527 2:202870888-202870910 ACCTGATGCTCTAAGGAAGACGG - Intronic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
948952817 2:241265527-241265549 AAATAGGGCACTATGGAAGATGG - Intronic
949080602 2:242095619-242095641 CACTAGTGCTCTAGCCAACAAGG - Intergenic
1169711304 20:8567212-8567234 AACTTGAGCTCCAGGGACGATGG + Intronic
1170733499 20:18993830-18993852 AATAACTGCTCTAGGAAAGAGGG - Intergenic
1172115185 20:32569527-32569549 AAGTAGTGCTCTAGGGAGTGCGG - Intronic
1172163552 20:32885055-32885077 CTCTAGTGCTCTGGGGTAGAGGG - Intronic
1174978319 20:55361064-55361086 AATTAGTGCACTTGGGTAGATGG + Intergenic
1177646140 21:23901886-23901908 ATCTAGTGATCTTGGGAAGAGGG + Intergenic
1177811160 21:25926148-25926170 AACAAATGGTCCAGGGAAGAAGG - Intronic
1179297797 21:40078968-40078990 AACTGGGGCTCTGGGGGAGAAGG + Exonic
1181900082 22:26146460-26146482 AACCACTGCTCTAGAGGAGAAGG - Intergenic
949714398 3:6912044-6912066 AACTAGTGTTCTTTGGAACATGG - Intronic
951132252 3:19061864-19061886 AATTAGTCCTCTAGGGCCGAAGG + Intergenic
952419197 3:33116175-33116197 AACAAGTGTTACAGGGAAGAGGG + Intronic
954407951 3:50355876-50355898 AACTAGTGCCCTAGGGCAGATGG + Intronic
960128054 3:114022553-114022575 AACTAATGGTCTAGGGAAGTTGG + Intronic
962881720 3:139584198-139584220 AACAAGTTCTCAAGGAAAGAAGG - Intronic
967627232 3:191701430-191701452 AACTTCTGCTTTGGGGAAGATGG + Intergenic
969854644 4:9989379-9989401 AAATAGTCCTCTAGGAGAGAAGG - Intronic
970970125 4:21973168-21973190 AACTAGTGGTTTAGTGAAAAGGG - Intergenic
971626057 4:28921590-28921612 AACTGGTGATCTAGGAAAGCTGG + Intergenic
972854274 4:43087488-43087510 AGCTAGTGATGTAGGGATGAAGG + Intergenic
973077210 4:45944220-45944242 AATTATTGTTCTAGGGAACAGGG - Intergenic
975382189 4:73713962-73713984 AACTAGTGCTCTATGGAAACTGG - Intergenic
976878579 4:89889656-89889678 AACTAAAGCCCTGGGGAAGAGGG - Intronic
977416306 4:96736531-96736553 AACTAGAGTTCTAGAGAAGAGGG + Intergenic
977622414 4:99152726-99152748 AACTAATGCACTAGGCCAGATGG - Intronic
977935603 4:102799995-102800017 AACTAGTACTCTTGGGAATATGG - Intronic
978471891 4:109077312-109077334 AAGCACTGCTCTAGGGAACATGG + Intronic
979559205 4:122083277-122083299 AATTAATGCTCCTGGGAAGATGG + Intergenic
983559592 4:169087363-169087385 TAGTACTGCTCTAGGAAAGATGG + Intergenic
984925148 4:184799955-184799977 AACTAGGGCTTTGGGGAAGGGGG - Intronic
986731897 5:10640922-10640944 AACTAGTGCCTTATGAAAGAGGG - Intronic
988505461 5:31818427-31818449 AACCAGTTCTCTGGGGAGGATGG - Intronic
989407716 5:41079833-41079855 AACTTGCACTCTAGGGGAGAAGG + Intergenic
989703122 5:44294637-44294659 AATTTTTGCTCTTGGGAAGATGG - Intergenic
991511493 5:67382047-67382069 AACTAGTTCTGTAGCAAAGAAGG + Intergenic
993861862 5:93145943-93145965 AACTGCAGCTGTAGGGAAGAGGG + Intergenic
995186081 5:109272357-109272379 AACCACTGCTCAAGGGAATAAGG - Intergenic
996202715 5:120696626-120696648 AAGTGGTTCTCTAGAGAAGATGG + Intergenic
996360659 5:122641882-122641904 AACTTGTTCTATTGGGAAGAGGG - Intergenic
997523309 5:134537030-134537052 ATCTCCTGCTGTAGGGAAGAAGG - Intronic
998645637 5:144058681-144058703 AACTACTGCTCAAGGAAATAAGG + Intergenic
1001461484 5:171918909-171918931 AACCAGTGCTCTAGGGATGTGGG + Intronic
1002978030 6:2105359-2105381 CACTTCTTCTCTAGGGAAGATGG + Intronic
1003844818 6:10162099-10162121 ACCTGGTGCTCAAGGGAATACGG - Intronic
1004210396 6:13635631-13635653 AACAAGAGATCTAGGGAAAAGGG + Intronic
1007149825 6:39678923-39678945 AAATACTGCTCTCTGGAAGAGGG - Intronic
1007238631 6:40409289-40409311 AATTTGTGCTCTAGTGAAGAAGG + Intronic
1009831032 6:68935307-68935329 AACTAGTGCTCTAGGGAAGAAGG - Intronic
1010443412 6:75925482-75925504 TCCTAGTGCTCATGGGAAGAAGG + Intronic
1012322250 6:97864115-97864137 AACAAGTCCTCCAGGGAAGCTGG - Intergenic
1013348802 6:109287860-109287882 AACTAGTGCTCCAGGGAGACAGG + Intergenic
1014730199 6:125023432-125023454 AAAGAGTGCTCCAGAGAAGAGGG + Intronic
1015037719 6:128677531-128677553 AACTCCTGCTTTAGGGAACAAGG + Intergenic
1017076952 6:150627807-150627829 CACTAGTGCTCAAGGCAAGAGGG - Intronic
1020234288 7:6343783-6343805 AACTAGAGATCTAGGGAGGAGGG + Intronic
1020687550 7:11314129-11314151 AGCCAGTGCTATAGGAAAGAGGG - Intergenic
1022773718 7:33502264-33502286 AAATAGCTCTCTGGGGAAGAAGG + Intronic
1023466068 7:40456582-40456604 AAAAAGTGGTCAAGGGAAGAGGG + Intronic
1024005901 7:45224753-45224775 AAGCTGTGCTCTGGGGAAGAGGG - Intergenic
1024708227 7:51985180-51985202 GAGAAGTGCTCTGGGGAAGATGG + Intergenic
1027761284 7:82282357-82282379 ACCGAGTGATCTAGGGAAGTTGG + Intronic
1031098048 7:117444343-117444365 GAATAGTGCTCTAGGCAAGCTGG + Intergenic
1031712282 7:125063929-125063951 AACTGGAGATCTAGGGAAGATGG + Intergenic
1032904180 7:136345433-136345455 AAGAAGTGGTCGAGGGAAGAAGG - Intergenic
1036290409 8:7483287-7483309 AACTTGTGCTTTAGAGAAGGAGG + Intronic
1036331077 8:7828248-7828270 AACTTGTGCTTTAGAGAAGGAGG - Intronic
1037470278 8:19201852-19201874 CTCTAATGCTCTCGGGAAGAGGG + Intergenic
1039198669 8:35061615-35061637 AACTTGGGCTCTGGGGAATAAGG - Intergenic
1041159500 8:55024890-55024912 ACCTTGTGCTCTATGTAAGAGGG + Intergenic
1042310060 8:67370629-67370651 AACTACTGCAGTAGGAAAGAGGG - Intergenic
1045620675 8:103974153-103974175 AAGTAGTGCCCTCAGGAAGAAGG - Intronic
1047948247 8:129904514-129904536 AACAAGTGAACTAGGAAAGAGGG - Intronic
1048408647 8:134149195-134149217 AACGACTGCTGAAGGGAAGATGG + Intergenic
1049737227 8:144215514-144215536 AAGTGGTCCTCTAGGGAGGAGGG - Intronic
1051596449 9:18828970-18828992 AACAAGTGCTCTGGAGAAAAAGG + Intronic
1051639844 9:19214467-19214489 TACTACTGCTCTAGGTAACAGGG + Intergenic
1051719818 9:20024968-20024990 GCCTGGTGGTCTAGGGAAGAGGG - Intergenic
1056205918 9:84319172-84319194 AACTATTGCAGTAGGGAAGAGGG - Intronic
1058628789 9:106964112-106964134 AACTAATGCTGTAGTGAACATGG + Intronic
1058932872 9:109739292-109739314 AACCAGTACTCTAAGGAAGATGG + Intronic
1059171161 9:112126495-112126517 AACTTGTTCTCTAGGGATTAAGG + Intronic
1060059544 9:120446778-120446800 CACTAGTCATCTTGGGAAGAAGG - Intronic
1060284271 9:122235058-122235080 AACTAGTAATCTAAGGGAGAAGG + Intergenic
1060925332 9:127451767-127451789 AACAAGTGCTCGAGGGAGCAGGG - Exonic
1060956892 9:127648059-127648081 AGCTGCTGCTCTAGGGAAGGAGG - Intronic
1188312244 X:28631458-28631480 AATAAGTGCTCTAGGGTAAAGGG + Intronic
1188666935 X:32835747-32835769 AACTAGTGATTTATGGCAGAGGG + Intronic
1189372437 X:40439579-40439601 AACTAGTGGTCTAGGCAGGAGGG - Intergenic
1194262937 X:91719762-91719784 AACTAGAAATCTAGAGAAGATGG + Intergenic
1194593199 X:95826459-95826481 AAACAGTGCTTTAGGGAGGAGGG - Intergenic
1194672323 X:96749723-96749745 AACAAGTGCCATTGGGAAGATGG + Intronic
1195920010 X:109974366-109974388 CACTTCTGCTTTAGGGAAGATGG - Intergenic