ID: 1009844765

View in Genome Browser
Species Human (GRCh38)
Location 6:69121735-69121757
Sequence GATGATGGGCAGCCAGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 11, 3: 59, 4: 312}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009844758_1009844765 4 Left 1009844758 6:69121708-69121730 CCGGGCAGAGGCGCACCTCACAT 0: 4
1: 872
2: 5945
3: 11411
4: 7013
Right 1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG 0: 1
1: 0
2: 11
3: 59
4: 312
1009844752_1009844765 24 Left 1009844752 6:69121688-69121710 CCTCCCAGATGGGGTGGCGGCCG 0: 63
1: 519
2: 1902
3: 1998
4: 1437
Right 1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG 0: 1
1: 0
2: 11
3: 59
4: 312
1009844750_1009844765 29 Left 1009844750 6:69121683-69121705 CCTCACCTCCCAGATGGGGTGGC 0: 106
1: 1263
2: 5111
3: 8098
4: 9390
Right 1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG 0: 1
1: 0
2: 11
3: 59
4: 312
1009844756_1009844765 20 Left 1009844756 6:69121692-69121714 CCAGATGGGGTGGCGGCCGGGCA 0: 157
1: 1581
2: 2900
3: 2929
4: 1899
Right 1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG 0: 1
1: 0
2: 11
3: 59
4: 312
1009844755_1009844765 21 Left 1009844755 6:69121691-69121713 CCCAGATGGGGTGGCGGCCGGGC 0: 194
1: 2673
2: 3967
3: 3737
4: 2226
Right 1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG 0: 1
1: 0
2: 11
3: 59
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009844765 Original CRISPR GATGATGGGCAGCCAGGCGT AGG Intronic
902760899 1:18580224-18580246 GGTGCTGGGCAGGCAGGTGTTGG - Intergenic
902887313 1:19415030-19415052 GATGCTTGGCAGCCAGGCCAAGG - Intronic
904418962 1:30379282-30379304 GAGGATGGGCAGGCAGGGGTGGG + Intergenic
904508744 1:30983207-30983229 CAAGAGGGGCAGCCAGGAGTGGG + Intronic
906355982 1:45106292-45106314 GACGATGGGCGGCCAGGCAGAGG - Intronic
906356053 1:45106518-45106540 GATGATGGGCGGCCGGGCAGAGG - Intronic
906778967 1:48555608-48555630 GATAATGGGAAGCCAGGGGAGGG + Intronic
907077937 1:51595080-51595102 AATGGAGGGCAGCCAGGTGTGGG - Intronic
909282314 1:73770878-73770900 GTTCATGGGCAGCCATGGGTGGG - Intergenic
910195854 1:84638878-84638900 GATCATTGGCAGCCAGGCCTAGG - Intergenic
911569750 1:99508225-99508247 GACCATGGGCAGCCAGGCAGAGG - Intergenic
911569906 1:99508831-99508853 GACGATGGGCGGCCAGGCAGAGG - Intergenic
912570933 1:110620434-110620456 GACGATGGGCAGCCATGCCTGGG - Intronic
912996693 1:114538035-114538057 CATGATGGGCAGCCAGGCTCTGG - Intergenic
913078271 1:115359874-115359896 GATGAAGGGCAGCCAGGCAGAGG + Intergenic
915937639 1:160098564-160098586 GAAGCGGGGCAGCGAGGCGTGGG + Exonic
915992660 1:160532350-160532372 GATGATGGGTGGCCAGGCAGAGG - Intergenic
916324925 1:163546107-163546129 GACGATGGGCGGCCAGGCAGAGG + Intergenic
917868078 1:179217004-179217026 GATGATTGGAGGCCAGGCGTGGG + Intronic
918327832 1:183427215-183427237 GATGATGGGCGGCCAGGCAGAGG - Intergenic
918701750 1:187616232-187616254 GATGATGGGCGGCCGGGCAGAGG - Intergenic
919133282 1:193477303-193477325 GATGATGGGCAGGCAGCTGTAGG + Intergenic
921007787 1:211111749-211111771 GATGGTGGGCAGCCAAGCAGAGG - Intronic
921007810 1:211111868-211111890 GATGGTGGGCAGCCAAGCAGAGG - Intronic
921007833 1:211111987-211112009 GATGGTGGGCAGCCAAGCAGAGG - Intronic
922482355 1:225947793-225947815 GATGAAGGGCACGCAGGCATGGG - Intergenic
923446129 1:234072949-234072971 GATGGTGGGAGGACAGGCGTGGG + Intronic
1064167716 10:13001309-13001331 GATGCTGTGCGACCAGGCGTGGG - Exonic
1064290067 10:14025696-14025718 GATGATGGCCAGGCAGCTGTGGG - Intronic
1066818707 10:39455942-39455964 GATGATTGGCAGCCAGGCAGAGG + Intergenic
1067100296 10:43329700-43329722 GATGATGGGCGGTCAGGCAGAGG - Intergenic
1067128900 10:43543874-43543896 GATGATGGGCAGCCGGGCAGAGG - Intergenic
1067128909 10:43543913-43543935 GATGATGGGCAGCCGGGCAGAGG - Intergenic
1067164675 10:43855875-43855897 GATGCTGGCCAGCCTGGCCTGGG + Intergenic
1067329805 10:45304344-45304366 GATGATGAGTAACCAGACGTTGG - Exonic
1067912020 10:50355717-50355739 GACGATGGGCGGCCAGGCAGAGG - Intronic
1068673172 10:59744107-59744129 GATGATGGGCAGCCAGGCAGAGG - Intergenic
1068967597 10:62928920-62928942 GACGATGGGCAGCCGGGTGGAGG + Intergenic
1069674674 10:70239022-70239044 GACGATGGGCAGCCGGGCAGAGG + Intergenic
1069674772 10:70239363-70239385 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1070754157 10:78981411-78981433 GGTGATGGGCAGACTGGGGTAGG + Intergenic
1072957066 10:99896572-99896594 GACAATGGGCAGCCAGGAGAGGG + Intronic
1073312229 10:102551249-102551271 GTTGATGGGCAGCCAGATTTAGG - Intronic
1074275017 10:111992834-111992856 GCTGATGTGCAGCCAGGCAGTGG + Intergenic
1075058225 10:119235992-119236014 GATGGGGGACAGCCAGGCATGGG - Intronic
1076783358 10:132736668-132736690 GCTGCTGGGCAGCCTGGCCTTGG - Intronic
1076914404 10:133414678-133414700 GACGATGGGCGGCCAGGCAGAGG + Intronic
1079354904 11:19722793-19722815 GATGGTGGGTGGCCAAGCGTAGG + Intronic
1080277171 11:30515454-30515476 TCTGATGGGCAGTCAGGCTTAGG + Intronic
1081632833 11:44701280-44701302 GATGTGGGGCACCCAGGCCTGGG - Intergenic
1081688096 11:45056605-45056627 GAGGATGGGGAGCCAGGAGGAGG - Intergenic
1081701897 11:45157672-45157694 GCTGATGGGCAGGCAGCCCTCGG + Intronic
1082008656 11:47435941-47435963 AAGGAGGGGCAGCCTGGCGTGGG - Intergenic
1083713735 11:64564102-64564124 GAAGGTGGGCGGCCAGGCATTGG + Intronic
1083871875 11:65493403-65493425 GAAGGTGGGCAGCCAGGGGATGG + Intergenic
1084711089 11:70844121-70844143 GATGTGGGGAAGCCAGGCGAGGG - Intronic
1084989551 11:72909905-72909927 GATGATGGGCAGCCGGGCAGAGG - Intronic
1084989632 11:72910207-72910229 GATGATGGGCAGCCAGGCAGAGG - Intronic
1085032253 11:73279890-73279912 TCTGATGGGCAGCCAGGGTTGGG + Intronic
1085456027 11:76665894-76665916 GGTGTTGTGCAGCCAGGCCTAGG + Exonic
1089255502 11:117191968-117191990 GACAATGGCCAGGCAGGCGTAGG - Exonic
1089642717 11:119858291-119858313 GATGAAGGGAAGGCAGGCGCCGG + Intergenic
1091123294 11:133074926-133074948 GATGGTGGACAGACAGGGGTGGG - Intronic
1091718872 12:2797923-2797945 GCTGGAGGGCAGCCAGGCATTGG - Intronic
1092322113 12:7487329-7487351 GATGACGGGCAGCCAGTGATGGG - Intronic
1092714460 12:11374549-11374571 GTTGATGGGCAGTCTGGCCTAGG + Intronic
1092718172 12:11413583-11413605 GTTGATGGGCAGTCTGGCCTAGG + Intronic
1095484882 12:42674425-42674447 GATCAAGGGCAGCCAGGAGCAGG - Intergenic
1096419085 12:51440824-51440846 GGTGAGGGGCAGCCTGGTGTGGG + Intronic
1096522356 12:52191555-52191577 CATGAAGGGCTGCCAGGCCTGGG - Intronic
1096532249 12:52249368-52249390 GCTCATGGTCAGCCAGGCCTGGG + Intronic
1097254742 12:57665028-57665050 GATGATGGGCAGCCAGGCAGAGG - Intergenic
1097254777 12:57665181-57665203 GACGATGGGCAGCCGGGCAGAGG - Intergenic
1097254865 12:57665488-57665510 GACGATGGGCAGCCGGGCAGAGG - Intergenic
1097446486 12:59678636-59678658 GCTCATGGGCAGCCACGGGTAGG + Intronic
1098023115 12:66175050-66175072 GACGATGGGCAGCCAGGCAGAGG - Intergenic
1098375316 12:69807788-69807810 GATGATGGGCAGCCAGGCAGAGG + Intronic
1098465634 12:70783592-70783614 GTTCATGGGCAGCCATGGGTGGG + Intronic
1098768096 12:74515190-74515212 ATTCATGGGCAGACAGGCGTGGG - Intergenic
1099683413 12:85856905-85856927 GTTCATGGGCAGCCATGGGTGGG + Intergenic
1103350087 12:120278115-120278137 GACGATGGGCAGCCGGGCAGAGG + Intergenic
1103350130 12:120278228-120278250 GATGAAGGGCGGCCAGGCAGAGG + Intergenic
1105267591 13:18836452-18836474 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1105411899 13:20177705-20177727 GCTGCTGGGCAGCGAGGCCTGGG - Intergenic
1105492482 13:20902444-20902466 GGTGCTGGGCAGCCAGGGGAAGG + Intronic
1105621863 13:22075696-22075718 GAGGATGGGCAGCGGGGAGTGGG - Intergenic
1105938888 13:25129120-25129142 GGTGATGGTCAGGCAGGGGTTGG + Intergenic
1105963144 13:25360777-25360799 GTTGCTGGGCATACAGGCGTGGG + Intergenic
1106495171 13:30269631-30269653 GACGATGGGCGGCCAGGCAGAGG - Intronic
1112216620 13:97436927-97436949 AATGATGGGAAGCCAGACGCTGG - Intronic
1112436681 13:99395583-99395605 GGTTGTGGGCAGCCAGGCTTGGG - Intergenic
1115901006 14:38148137-38148159 CATGATGGGAAGGCAGGGGTTGG + Intergenic
1121256573 14:92534702-92534724 GCTGAGGGGCAGCCAGGCAGGGG + Intronic
1121427713 14:93864541-93864563 GATGAGGGGCAACCAGACGGGGG + Intergenic
1122386060 14:101349089-101349111 GTTCATGGGCAGCCATGGGTGGG + Intergenic
1122518765 14:102327626-102327648 GATGATGAGCAGGCAGGGGCAGG - Intronic
1122809351 14:104280365-104280387 AATGATGGGAAGCCATGGGTGGG + Intergenic
1123059210 14:105586850-105586872 GAGGATGGACAGACAGGCGCCGG + Intergenic
1123083541 14:105707081-105707103 GAGGATGGACAGACAGGCGCCGG + Intergenic
1124146302 15:27128468-27128490 GATTATGGGCTTCAAGGCGTGGG - Intronic
1124891505 15:33738009-33738031 GATGGTGGGCTGCAAGTCGTGGG - Intronic
1125031999 15:35082726-35082748 GATGATGGGCAGCCGGGCAGAGG - Intergenic
1127088592 15:55446376-55446398 GATGATGGGCGGCCGGGCAGAGG + Intronic
1127088644 15:55446566-55446588 GATGAAGGGCAGCCAGGCAGAGG + Intronic
1127088749 15:55446947-55446969 GATGATGGGCGGCCGGGCAGAGG + Intronic
1127088807 15:55447174-55447196 GATGATGGGCGGCCGGGCAGAGG + Intronic
1127192012 15:56540659-56540681 GACGATGGGCGGCCAGGCAGAGG - Intergenic
1127625951 15:60780332-60780354 GGTGATGTGCAGACAGGCCTGGG + Intronic
1128333602 15:66771995-66772017 GAAGATGGGCAGCATGTCGTGGG + Intronic
1128500108 15:68221863-68221885 GACGATGGGCAGCCAGGCAGAGG - Intronic
1128500147 15:68222013-68222035 GACGATGGGCAGCCGGGCAGAGG - Intronic
1128500239 15:68222314-68222336 GACGATGGGCAGCCAGGCAGAGG - Intronic
1128982914 15:72199441-72199463 CATGATGGGCAGCCAGGCTCTGG + Exonic
1129742790 15:77998019-77998041 GAGGAAGGGCAGCCTGGCTTGGG + Exonic
1129842682 15:78753428-78753450 GAGGAAGGGCAGCCTGGCTTGGG - Intergenic
1131057381 15:89383717-89383739 GAGGAGGGGCAGCCAGGAGAGGG - Intergenic
1131232102 15:90666833-90666855 GCTGAGGAGCAGCCAGGCCTGGG + Intergenic
1132630284 16:914049-914071 GTTGATGGGCCGCGAGGCCTGGG + Intronic
1132864035 16:2084914-2084936 GATGGTGGGCACCCAGGTGAGGG - Intronic
1133976817 16:10605108-10605130 GATGATGGGCAGGCAGAAATAGG - Intergenic
1135575538 16:23583221-23583243 GACGATGGGCGGCCAGGCAGAGG - Intronic
1135633719 16:24056352-24056374 GATGATGGGCAGACTGACATTGG + Intronic
1136683543 16:31981495-31981517 GATGAGGGGCAGCCTGGGGAGGG + Intergenic
1137388150 16:48059381-48059403 GACGATGGGCGGCCAGGCAGAGG + Intergenic
1138137911 16:54539569-54539591 GATGATGGGCAGGAAGGAGATGG - Intergenic
1139472767 16:67187110-67187132 AATGATGGGGAGCCTGGAGTTGG - Exonic
1139956159 16:70693984-70694006 TCTGCTGGGCAGCCAGGCCTAGG - Intronic
1140230716 16:73115133-73115155 GATGAGGGGCAGCCAGGATCAGG - Intergenic
1141548326 16:84787100-84787122 GATTCTGGGCAGCCAGCCTTCGG + Intergenic
1142104076 16:88292632-88292654 GATGGTGGCCAGCCAGGCCTCGG + Intergenic
1142963289 17:3564599-3564621 GACGATGGGCGGCCAGGCAGAGG + Intergenic
1143526872 17:7478252-7478274 GATCATGGGCAGCCAAGCGAGGG - Intronic
1144559841 17:16312356-16312378 GACGATGGGCAGCCGGGTGGAGG + Intronic
1145241086 17:21241434-21241456 GAGGATGGGCAGCCAGGCCTGGG - Exonic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1145894918 17:28450353-28450375 GATGTTGGGCAGCCAAGGGGAGG + Intergenic
1145976785 17:28988511-28988533 GAAGATGGGCAGCCAGCCCTTGG + Intronic
1146361474 17:32179808-32179830 GACGATGGGCGGCCAGGCAGAGG - Intronic
1147144457 17:38477202-38477224 GATGAGGGGCAGCCTGGGGAGGG + Intronic
1149576293 17:57715838-57715860 GGTGATGGGCAGCCTCGGGTGGG + Intergenic
1152274628 17:79349123-79349145 GATGATGGAGCGCCAGGCGTGGG - Intronic
1154115912 18:11613361-11613383 GACGATGGGCGGCCAGGCAGAGG - Intergenic
1154116027 18:11613796-11613818 GATGATGGGCGGCCAGGCAGAGG - Intergenic
1154120308 18:11647392-11647414 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1154120366 18:11647588-11647610 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1154120469 18:11647946-11647968 GACGATGGGCGGCCAGGCAGAGG - Intergenic
1154420242 18:14222923-14222945 GATGCAGGGCAGCCAGGCAGAGG - Intergenic
1154420521 18:14223948-14223970 GATGATGGGCGGCCAGGCAGAGG - Intergenic
1154420625 18:14224285-14224307 GATGATGGGCGGCCAGGCAGAGG - Intergenic
1154420765 18:14224772-14224794 GATGATGGGCAGCTGGGCAGAGG - Intergenic
1154483019 18:14855624-14855646 GATGAAGGGCAGCCAGGCAGAGG + Intergenic
1154483062 18:14855776-14855798 GACAATGGGCAGCCAGGCAGAGG + Intergenic
1154483111 18:14855963-14855985 GATGATGGGCAGCTGGGCAAAGG + Intergenic
1154483258 18:14856529-14856551 GATGATGGGCAGCCAGGCAGAGG + Intergenic
1154483331 18:14856835-14856857 GACAATGGGCAGCCAGGCAGAGG + Intergenic
1154483377 18:14857023-14857045 GACGAAGGGCAGCCAGGCAGAGG + Intergenic
1154483422 18:14857175-14857197 GACAATGGGCAGCCAGGCAGAGG + Intergenic
1154483471 18:14857362-14857384 GATGATGGGCAGCTGGGCAAAGG + Intergenic
1154483533 18:14857586-14857608 GATGATGGGCAGCTGGGCAAAGG + Intergenic
1154483677 18:14858149-14858171 GATGATGGGCAGCCAGGCAGAGG + Intergenic
1154483751 18:14858455-14858477 GACAATGGGCAGCCAGGCAGAGG + Intergenic
1154483797 18:14858643-14858665 GACGAAGGGCAGCCAGGCAGAGG + Intergenic
1154483842 18:14858795-14858817 GACAATGGGCAGCCAGGCAGAGG + Intergenic
1154483891 18:14858982-14859004 GATGATGGGCAGCTGGGCAAAGG + Intergenic
1154483954 18:14859206-14859228 GATGATGGGCAGCTGGGCAAAGG + Intergenic
1154484098 18:14859769-14859791 GATGATGGGCAGCCAGGCAGAGG + Intergenic
1155367799 18:25066195-25066217 AATGGTGGACAGCCAGGCCTGGG - Intronic
1157342557 18:46792221-46792243 GAGGATGGGGACCCAGGCATGGG - Intergenic
1158659948 18:59377909-59377931 GATTATGGGCAGCCATACATTGG - Intergenic
1161686954 19:5707648-5707670 GGTGGGGTGCAGCCAGGCGTGGG + Intronic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1163327650 19:16615451-16615473 AATTTGGGGCAGCCAGGCGTGGG + Intronic
1164016594 19:21260259-21260281 GATGATGGGCAGCCGGGCAGTGG + Intronic
1164017415 19:21265064-21265086 GATGGTGGGCAGCCGGGCAGAGG - Intronic
1164542222 19:29129538-29129560 GATGATGTGAAGACATGCGTTGG + Intergenic
1165295497 19:34922524-34922546 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1166418087 19:42610706-42610728 GATGATGGGCGGCCAGGCAGAGG + Intronic
1166884055 19:45948308-45948330 GATTATTGTCAGCCGGGCGTGGG + Intronic
1167134939 19:47610235-47610257 GACGAGGGGCAGCCAGGGATGGG - Intronic
1167588378 19:50388144-50388166 GATGAGTGGCTGCCAGGGGTGGG + Intronic
926313596 2:11693298-11693320 TCTGATGTGCAGCCAGGCTTGGG + Intronic
927226191 2:20767734-20767756 GTCCATGGGCAGCCAGGGGTAGG - Intronic
927266897 2:21162160-21162182 GTTCATGGGCAGCCATGGGTGGG + Intergenic
927720040 2:25376676-25376698 GATGCTGGGGAGCCAGCTGTGGG + Intergenic
928217236 2:29371829-29371851 GAGGAGGTGCAGCCAGGCCTGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
932420892 2:71600779-71600801 GACGAGGGGCAGCCAGCCGTCGG + Exonic
932446673 2:71785901-71785923 GATGAAGGGCCGGCAGGCGCTGG - Intergenic
933063595 2:77768184-77768206 GTTCATGGGCAGCCATGGGTGGG - Intergenic
933868920 2:86548880-86548902 GACGATGGGCAGCCGGGCAGAGG + Intronic
933868944 2:86548955-86548977 GATGATGGGCAGCTGGGCAGAGG + Intronic
933868966 2:86549031-86549053 GATGAAGGGCAGCCGGGCAGAGG + Intronic
936071102 2:109371893-109371915 GATGACTTGCAGCCAGGCCTGGG - Intronic
938055019 2:128208325-128208347 GATGGTGGGCAGCCGGGCAGAGG - Intergenic
938055027 2:128208364-128208386 GATGGTGGGCAGCCAGGCAGAGG - Intergenic
938055138 2:128208876-128208898 GATGGTGGGCAGCCAGGCAGAGG - Intergenic
938055154 2:128208954-128208976 GATGGTGGGCAGTCAGGCAGAGG - Intergenic
938055266 2:128209466-128209488 GATGGTGGGCAGCCGGGCATAGG - Intergenic
938055283 2:128209544-128209566 GACGGTGGGCAGCCAGGCAAAGG - Intergenic
939589139 2:144042279-144042301 GATTATGGGCAGGCAGGCTAAGG + Intronic
939647352 2:144717021-144717043 GGTGATTGGCTGCCAGGAGTAGG + Intergenic
942313268 2:174675878-174675900 GAGGATGGGCATGAAGGCGTGGG + Intronic
943125661 2:183791952-183791974 GATGATGGGCAGCCAGGCAGAGG + Intergenic
943125717 2:183792139-183792161 GACGATGGGCAGCCAGGCAGAGG + Intergenic
944229848 2:197381546-197381568 GATGGTGGGCAGCCGGGCAGAGG - Intergenic
944785615 2:203066851-203066873 GATGATGGGCGGCCGGGCAGAGG + Intronic
944901813 2:204223453-204223475 GTCCATGGGCAGCCAGGGGTGGG + Intergenic
945030106 2:205655359-205655381 ATTAATGGGCAGCCAGGCTTGGG + Intergenic
946804875 2:223462136-223462158 GATAATGGGCAGGCAGAGGTTGG + Intergenic
947701481 2:232238079-232238101 GAGGTAGGGCAGCCAGGTGTGGG + Intronic
1169125579 20:3124908-3124930 GATGATGGGTGGCCAGGCAGAGG - Intronic
1169125705 20:3125401-3125423 GATGATGGGCGGCCGGGCAGAGG - Intronic
1169125724 20:3125477-3125499 GATGATGGGCGGCCGGGCAGAGG - Intronic
1169125785 20:3125710-3125732 GATGATGGGCGGCCAGGCAGAGG - Intronic
1169788418 20:9385386-9385408 GATGATGGGCGGCCAGGCAGAGG + Intronic
1171951546 20:31426744-31426766 GACGATGGGCGGCCAGGCAGAGG - Intergenic
1172110886 20:32544285-32544307 GATGATGGGAAGGCAGGGGGCGG + Intronic
1172435863 20:34928553-34928575 GATGAGGGGCTGACAGGAGTGGG + Exonic
1172624639 20:36340216-36340238 GCTGTTGGGCAGCCAGGAGAAGG - Intronic
1173883714 20:46438637-46438659 GATGAGGGGCAGGTAGGAGTAGG + Intergenic
1174485798 20:50860429-50860451 GATGAGTGGTAGCCAGGGGTTGG - Intronic
1175547542 20:59788396-59788418 GAGGAGGGGCTGCCAGGCGTGGG - Intronic
1175644336 20:60658383-60658405 GATGCTGGGAACCCAGGCTTAGG + Intergenic
1176797261 21:13379661-13379683 GATGATGGGCGGCCAGGCAGAGG - Intergenic
1176797584 21:13380953-13380975 GACGAAGGGCAGCCAGGCAGAGG - Intergenic
1176852640 21:13934919-13934941 GATGATGGGCGGCCAGGCAGAGG + Intergenic
1176852801 21:13935482-13935504 GATGATGGGCGGCCAGGCAGAGG + Intergenic
1179881320 21:44294367-44294389 GATGAGGGGCTGCCAGCCCTGGG - Intronic
1180806731 22:18718511-18718533 GCTGAAGGGCATCGAGGCGTAGG + Intergenic
1181628194 22:24135493-24135515 GATGAGAGGCAGGCAGGCCTAGG - Intronic
1181727619 22:24822409-24822431 GATCAGGGGCTGCCAGGGGTTGG - Intronic
1183072717 22:35407495-35407517 GAGGAGGGGCAGCGAGGCCTGGG - Intronic
1183081968 22:35462542-35462564 GAGGATGGGCAGCCCTGCCTGGG + Intergenic
1183434661 22:37786631-37786653 GACGATGGGCGGCCAGGCAGAGG - Intergenic
1184093296 22:42303621-42303643 CATGATGGCCAGCCAGGTGAAGG + Intronic
1184114028 22:42411699-42411721 CATGATGGGCAGGCCGGTGTGGG + Exonic
1184116792 22:42426963-42426985 GATGCTGAGCACCCAGGCGGGGG + Intronic
949565710 3:5243017-5243039 GACGATGGGCGGCCAGGCAGAGG + Intergenic
949907416 3:8870300-8870322 GATGAGAAGCAGCCAGCCGTGGG + Intronic
950029425 3:9842455-9842477 GATGATAGGGAGCCAGACCTGGG - Intronic
950073468 3:10170712-10170734 AATGATGAGCTGCCAGGCCTTGG + Intronic
953307066 3:41841048-41841070 GATGATGGGCGGCCAGGCAGAGG - Intronic
953552168 3:43911839-43911861 GCTGATGGGGAACCAGGCTTTGG - Intergenic
954003877 3:47577869-47577891 GGTGAAGGGCAGCCCGGCGTGGG - Exonic
954687099 3:52376961-52376983 GAGAATGGGCAGCCAGGGATGGG - Intronic
954855907 3:53643306-53643328 GCTGGTGGGCAGGCAGGCGTCGG - Intronic
958406441 3:93761899-93761921 GATGATGGGCAGCTGGGCAGAGG + Intergenic
958406545 3:93762274-93762296 GATGATGGGCAGCCAGGCAGAGG + Intergenic
958406841 3:93763319-93763341 GATGATGGGCGGCCAGGCAGAGG + Intergenic
958407099 3:93764221-93764243 GATGAAGGGCAGCCGGGCAGAGG + Intergenic
958407251 3:93764783-93764805 GATGATGGGCGGCCAAGCAGAGG + Intergenic
958431459 3:94044674-94044696 GACGATGGGCAGCCGGGCAGAGG - Intronic
958777381 3:98502471-98502493 TAAGATGGGCAGTCAGGGGTGGG + Intronic
959942207 3:112091607-112091629 TCTGATGTGCAGCCAGGCTTGGG + Intronic
962735352 3:138320741-138320763 AAGGATGGGCAGCCAGGCACAGG + Intronic
964485086 3:157178664-157178686 GATGATGGGCGGCCGGGCAGAGG + Intergenic
964485162 3:157178965-157178987 GATGATGGGCGGCCAGGCAGAGG + Intergenic
964485181 3:157179043-157179065 GATGATGGGCAGCCGGGCAGAGG + Intergenic
964485247 3:157179304-157179326 GATGATGGGCGGCCGGGCAGAGG + Intergenic
964485303 3:157179522-157179544 GACGAAGGGCAGCCAGGCAGAGG + Intergenic
964485312 3:157179561-157179583 GATGATGGGCGGCCAGGCAGAGG + Intergenic
964485334 3:157179637-157179659 GATGATGGGCGGCCGGGCAGAGG + Intergenic
968754163 4:2406441-2406463 GAGGTGGGGCAGCCAGGCCTGGG + Intronic
970560780 4:17280285-17280307 GATGATTTGAAGCCAGGCTTTGG + Intergenic
976976155 4:91168239-91168261 GATGATGGGCAGCCGGGCAGAGG - Intronic
976976241 4:91168540-91168562 GATGATGGGCAGCCGGGCAGAGG - Intronic
980104492 4:128574868-128574890 GGTGGTGGGGAGCCAGGCATGGG - Intergenic
981753126 4:148112552-148112574 GATGATGGCAAGCAAGGCTTTGG - Intronic
985770188 5:1804979-1805001 GATCAGGGGCTGCCAGGGGTTGG - Intronic
986387382 5:7247900-7247922 GCTGATAGGCAGACAGGCCTAGG + Intergenic
988532513 5:32039661-32039683 GACGATGGGCGGCCAGGCAGAGG - Intronic
989071833 5:37519454-37519476 GATGATGGGCTGCCGGGCGGAGG + Intronic
989991695 5:50774555-50774577 GATGATGGGCGGCCGGGCAGAGG + Intronic
990709116 5:58563299-58563321 GACGATGGGCGGCCAGGCAGAGG + Intergenic
990709136 5:58563375-58563397 GATGATGGGCGGCCTGGCAGAGG + Intergenic
990709276 5:58563869-58563891 GATGAAGGGCAGCCTGGCAGAGG + Intergenic
991221597 5:64225393-64225415 GACGATGGGCGGCCAGGCAGAGG - Intronic
991910205 5:71552411-71552433 GACGATGGGCGGCCAGGCAGAGG + Intronic
991935158 5:71793889-71793911 GACGATGGGCAGCCGGGCAGAGG + Intergenic
991935287 5:71794317-71794339 GATGATGGGCGGCCGGGCAGAGG + Intergenic
995226047 5:109702366-109702388 GAGGATGGGCAGCCCGGTGGTGG + Intronic
995726935 5:115191144-115191166 GATGAAGAGCAGCCAGCTGTTGG - Intergenic
996688718 5:126313976-126313998 CATGATGGGAAGGCAGGGGTTGG - Intergenic
997433555 5:133858079-133858101 GACGATGGGCAGCCAGTCAGAGG + Intergenic
998172430 5:139880531-139880553 GAGGCTGGGCTGCCAGGAGTGGG - Intronic
999251404 5:150184355-150184377 CCTGATGGGCAGCCTGGCGGGGG - Exonic
999751399 5:154630604-154630626 GATTAGGGCCAGCCAGGCCTGGG + Intergenic
999986954 5:157014103-157014125 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1001038297 5:168314066-168314088 GATGAGGGCCAGCCAGAGGTGGG + Intronic
1001117110 5:168948971-168948993 CCTGAAGGGCAGCCAGGTGTGGG - Intronic
1001699929 5:173699441-173699463 GACGATGGGCGGCCAGGCCTGGG + Intergenic
1002044505 5:176534360-176534382 GATGATGGGCAGGCAGAGGTTGG - Intronic
1002118486 5:176983791-176983813 GACGATGGGCGGCCAGGCAGGGG - Intronic
1002222691 5:177695870-177695892 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1002222749 5:177696063-177696085 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1002461101 5:179374252-179374274 GCTGTTCGGCAGCCAGGCATAGG + Intergenic
1003087514 6:3072574-3072596 GATGATGGGCCGGCATACGTTGG + Intronic
1003422913 6:5974199-5974221 CATGATGGGCAGCCAGGCTCCGG - Intergenic
1004691527 6:17996372-17996394 AAGGATGGTCAGCCAGGTGTGGG - Intergenic
1004891118 6:20101624-20101646 GATGCTGGGAACCCAGGCATCGG - Intergenic
1006935725 6:37716150-37716172 GATGTTGGGCAGCCAAGAGGTGG - Intergenic
1007735942 6:43982226-43982248 CATGCAGGGCAGCCAGGCCTGGG - Intergenic
1008490102 6:52077630-52077652 GATGGTGGCTTGCCAGGCGTAGG + Intronic
1008571967 6:52825278-52825300 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1009392931 6:63164582-63164604 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG + Intronic
1012011078 6:93786555-93786577 GATGCTGAGCAGCCAGGCACTGG - Intergenic
1017097540 6:150817897-150817919 GCTGATGATCAGCCAGGCTTCGG + Intronic
1017773362 6:157660681-157660703 TAGGGTGGGCAGCCAGGCCTTGG + Intronic
1019128335 6:169856628-169856650 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1020219347 7:6223101-6223123 GACGAAGGGCAGCCAGGCAGAGG - Intronic
1021995600 7:26176503-26176525 GACGATGGGCAGCCGGGCAGAGG + Intronic
1021995629 7:26176616-26176638 GACGATGGGCAGCCGGGCAGAGG + Intronic
1021995658 7:26176729-26176751 GACGATGGGCAGCCGGGCAGAGG + Intronic
1023291052 7:38669478-38669500 GAGGGTGGTCAGCCAGGAGTAGG + Intergenic
1024944169 7:54792425-54792447 GAAGGTGGGCAGCCAGGCAGAGG + Intergenic
1026163356 7:67889452-67889474 GATGGTTGGCAGCCAGGCAGAGG - Intergenic
1026163433 7:67889842-67889864 GATGGTCGGCAGCCAGGCAGAGG - Intergenic
1026185821 7:68082096-68082118 GACGATGGGCAGCCGGGCAGTGG - Intergenic
1026186220 7:68083593-68083615 GACGATGGGCAGCCGGGCAGAGG - Intergenic
1028535786 7:91888164-91888186 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1028535796 7:91888203-91888225 GATGATGGGCGGCCAGGCAGAGG - Intergenic
1028535816 7:91888279-91888301 GACGATGGGCAGCCGGGCAGAGG - Intergenic
1028535949 7:91888772-91888794 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1028548195 7:92027229-92027251 GACGATGGGCAGCCGGGCAGAGG - Intronic
1029611600 7:101629563-101629585 GATGATGGGGAGCCAGAAGGGGG + Intergenic
1030288262 7:107848113-107848135 GACGATGGGCTGCCAGGCAGAGG - Intergenic
1032129462 7:129216407-129216429 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1037608516 8:20457392-20457414 GCTTTTGGGCAGCCAGGAGTTGG - Intergenic
1037817443 8:22119703-22119725 GATGACAGGCAGACAGGCATGGG + Intronic
1038017658 8:23529020-23529042 GAGCGTGGGCAGCCAGGCGGTGG + Exonic
1039819272 8:41122038-41122060 TAAGATGGGCAGCCAGTCTTTGG + Intergenic
1040517794 8:48148570-48148592 GACGGTGGGCAGCCAGGCAGAGG - Intergenic
1043050273 8:75377204-75377226 CATGATGGGCAGCCAGGCTCTGG - Intergenic
1044560315 8:93606112-93606134 GATGATGGGGAGGCAGCCATGGG + Intergenic
1044581888 8:93833391-93833413 GACGATGGGCAGCCGGGCAGAGG + Intergenic
1045542644 8:103101316-103101338 GCTGATGGGCAGCCAGACTGAGG + Intergenic
1046730361 8:117718821-117718843 CATGATGAGCAGCCAGACCTTGG - Intergenic
1049510612 8:143025000-143025022 GCTGCTGGGCGGCCAGGCGGGGG + Intergenic
1050020448 9:1279352-1279374 GATGATGGGAAGTTAGGGGTAGG - Intergenic
1050417985 9:5434620-5434642 GATGATGGGTGGCCAGGCAGAGG - Intronic
1052259216 9:26493128-26493150 GATGAAGGGCAGCCGGGCAGAGG - Intergenic
1052771398 9:32694125-32694147 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1053081797 9:35183537-35183559 GATGAAGGGCGGCCAGGCAGAGG + Intronic
1053081860 9:35183763-35183785 GACGATGGGCGGCCAGGCAGAGG + Intronic
1053575664 9:39356059-39356081 GAGGCAGGGCAGCCAGGGGTTGG + Intronic
1053840182 9:42184016-42184038 GAGGCAGGGCAGCCAGGGGTTGG + Intronic
1054097234 9:60914764-60914786 GAGGCAGGGCAGCCAGGGGTTGG + Intergenic
1054118640 9:61190393-61190415 GAGGCAGGGCAGCCAGGGGTTGG + Intronic
1054589117 9:66992171-66992193 GAGGCAGGGCAGCCAGGGGTTGG - Intergenic
1055133987 9:72806659-72806681 GATGATGGGCGGCCGGGCAGAGG + Intronic
1055987137 9:82063332-82063354 GAGGCAGGGCAGCCAGGGGTTGG - Intergenic
1056583763 9:87914848-87914870 GAGGCAGGGCAGCCAGGGGTTGG + Intergenic
1056584255 9:87918317-87918339 GAGGCAGGGCAGCCAGGGGTTGG + Intergenic
1056612615 9:88134608-88134630 GAGGCAGGGCAGCCAGGGGTTGG - Intergenic
1056613111 9:88138098-88138120 GAGGCAGGGCAGCCAGGGGTTGG - Intergenic
1057160039 9:92882929-92882951 GAGGCAGGGCAGCCAGGGGTTGG + Intergenic
1057624850 9:96667951-96667973 GATGCTGGGCTGCCAGTCGTGGG + Intergenic
1058368160 9:104234811-104234833 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1058952346 9:109915525-109915547 GATGATGTGCAGCCAGAATTTGG - Intronic
1060557267 9:124514440-124514462 CCTGATGGGCAGCCAGGCCAAGG + Intergenic
1061976499 9:134070569-134070591 GATGATGGGCTGCTAGGGGCTGG - Intergenic
1062645780 9:137547465-137547487 GTGGTTGGGCAGCCAGGGGTGGG - Intronic
1185891693 X:3827835-3827857 GATGATGGGCAGGCAGAGGCAGG + Intronic
1185896802 X:3866249-3866271 GATGATGGGCAGGCAGAGGCAGG + Intergenic
1185901920 X:3904676-3904698 GATGATGGGCAGGCAGAGGCAGG + Intergenic
1189421776 X:40862879-40862901 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1190153174 X:47965657-47965679 GATGGTGGGCAGCCAGCCAGAGG - Intronic
1191942931 X:66499612-66499634 CATGATGGGCAGCCAGGCTCTGG - Intergenic
1192123524 X:68478924-68478946 GATGATGGACAGCCGGGCAGAGG - Intergenic
1192455097 X:71269763-71269785 GATGGTGGGCAGCCAGGCAGAGG + Intergenic
1192455186 X:71270137-71270159 GATGGTGGGCAGCCGGGCAGAGG + Intergenic
1192664084 X:73069580-73069602 GATGAAGGGCGGCCAGGCAGAGG - Intergenic
1192664149 X:73069801-73069823 GACGATGGGCAGCCGGGCAGAGG - Intergenic
1192885659 X:75334697-75334719 GATGATGGGTGGCCAGGCAGAGG + Intergenic
1192885819 X:75335215-75335237 GATGAAGGGCAGCCAGGCAGAGG + Intergenic
1197859067 X:130950147-130950169 GCTGATGGGCAGGCAGGCTCTGG + Intergenic
1200138337 X:153885634-153885656 GATGAGGGGCAGCCACGCCCAGG + Intronic
1201294650 Y:12453247-12453269 GATGATGGGCAGCAGGGCAGAGG + Intergenic
1201294793 Y:12453785-12453807 GATGATGGGCAGCCAGGCAGAGG + Intergenic
1202028956 Y:20552413-20552435 GATGAAGGGCAGCCAGGCAGAGG - Intergenic
1202029001 Y:20552560-20552582 GAAGATGGGCGGCCAGGCAGAGG - Intergenic
1202113890 Y:21451739-21451761 GATTATGGGGAGCCCCGCGTTGG + Intergenic