ID: 1009846972

View in Genome Browser
Species Human (GRCh38)
Location 6:69146324-69146346
Sequence CAGAGTGAGCACTGGGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009846964_1009846972 24 Left 1009846964 6:69146277-69146299 CCAGGTTGTGACAGTGCCCAGGC 0: 4
1: 19
2: 37
3: 95
4: 264
Right 1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG No data
1009846966_1009846972 8 Left 1009846966 6:69146293-69146315 CCCAGGCTTGGCTTCAACTTTGC 0: 4
1: 33
2: 70
3: 168
4: 446
Right 1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG No data
1009846962_1009846972 29 Left 1009846962 6:69146272-69146294 CCTGGCCAGGTTGTGACAGTGCC 0: 4
1: 11
2: 48
3: 120
4: 277
Right 1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG No data
1009846967_1009846972 7 Left 1009846967 6:69146294-69146316 CCAGGCTTGGCTTCAACTTTGCT 0: 4
1: 29
2: 60
3: 127
4: 365
Right 1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009846972 Original CRISPR CAGAGTGAGCACTGGGAATG GGG Intronic
No off target data available for this crispr